Table 3

Oligonucleotides used for PCR

Oligo

Sequence


C-term TAP F

ATGGAAAAGAGAAGATGGAAAAAG

C-term TAP R

GGTTGACTTCCCCGC

FLAG-GFP F

ATGGATTACAAGGACGATGACGATAAGATGAG

FLAG-GFP R

CAAAGCTTGTGGGCTTTTGTATAG

N-term TAP F

ATGGCAGGCCTTGCGC

N-term TAP R

AAGTGCCCCGGAGGATGAGATTTTCT

R6K F

CCTTAGAGGCTATTTAAGTTGCTG

R6K R

GTACTAAGCTCTCATGTTTCAC

RT screen F

ACGTTAACCGGGCTGCAT

RT screen R

GCCGTCAATAAGTTCTGTCAA

unc-119 F

CAAATCCGTGACCTCGACAC

unc-119 R

CACAGTTGTTTCTCGAATTTGG


Zhang et al. BMC Developmental Biology 2008 8:119   doi:10.1186/1471-213X-8-119

Open Data