Table 1

PCR Primer Sequences for Amplification of Ccm2, Map3k3, Map2k3, Map2k6, Map2k4, H2afz, and Luciferase

Gene product

Primer

Primer Sequence

Size (bp)

Ensembl Transcript ID


Ccm2

5'

TCTGCTCAGTCTGTCTGCCTA

371

ENSMUST00000000388

3'

CAAATATTGCTCGGTCCAGAA

Map3k3

5'

CCATCCTTCAGGAAATCACAA

374

ENSMUST00000002044

3'

CAATTGATGGGAGCACTAGGA

Map2k3

5'

AGCCTATGGGGTGGTAGAGAA

387

ENSMUST00000019076

3'

CCTTCCTTGTTGATGAGGACA

Map2k6

5'

AGATGACCTGGAGCCGATAGT

395

ENSMUST00000019076

3'

GCTTGACGTCTCGATGGATAA

Map2k4

5'

TGGAGCTCATGTCTACCTCGT

363

ENSMUST00000046963

3'

CGTACAATGTGATCCCCAAAC

H2afz

5'

CTCACCGCAGAGGTACTTGAG

375

ENSMUST00000041045

3'

ATGCAGAAATTTGGTTGGTTG

Luciferase

5'

TTGACAAGGATGGATGGCTAC

354

N/A

3'

GTTTTCCGGTAAGACCTTTGC


Fong et al. BMC Developmental Biology 2007 7:2   doi:10.1186/1471-213X-7-2

Open Data