Table 1

Primers used in this study (5' to 3')

Gene

Forward

Reverse

Amplicon size (BP)


HOXA13 (WISH)

CTACTTCGGCAGCGGTTA

TGTCGTCTTGAGTTTGTTGA

676

HOXD13 (WISH)

GTTCATCCTCTTCCTCCTC

AATGGCGTATTCGTTCTC

656

HOXA13 (PCR)

ACCTCTGGAAGTCCACTCTG

CTTGGTGTAAGGCACTCGTT

95

HOXD13 (PCR)

CTGGACTCTGGCGAATGG

GGTTTGTGGCTGCGGATA

251

M13puc (sequencing)

CCCAGTCACGACGTTGTAAAACG

AGCGGATAACAATTTCACACAGG


Chew et al. BMC Developmental Biology 2012 12:2   doi:10.1186/1471-213X-12-2

Open Data