Table 5

Sequences of primers and ISH probes.

DNA oligonucleotides


Name

5'-3' nucleotide sequence


Let-7d

AGAGGTAGTAGGTTGCATAGT


miR-9

TCTTTGGTTATCTAGCTGTATGA


miR-24

TGGCTCAGTTCAGCAGGAACAG


miR-25

CATTGCACTTGTCTCGGTCTGA


miR-27a

TTCACAGTGGCTAAGTTCCGC


miR-34a

TGGCAGTGTCTTAGCTGGTTGTT


miR-34b

TAGGCAGTGTAATTAGCTGATTG


miR-122

TGGAGTGTGACAATGGTGTTTG


miR-124

TAAGGCACGCGGTGAATGCC


miR-128

TCACAGTGAACCGGTCTCTTTT


miR-125a-5p

TCCCTGAGACCCTTTAACCTGTGA


miR-125b-5p

TCCCTGAGACCCTAACTTGTGA


miR-130a

CAGTGCAATGTTAAAAGGGCAT


miR-130b

CAGTGCAATGATGAAAGGGCAT


miR-150

TCTCCCAACCCTTGTACCAGTG


miR-204

TTCCCTTTGTCATCCTATGCCTG


miR-326

CCTCTGGGCCCTTCCTCCAGT


miR-370

GCCGGCTGGGGTGGAACGTGGTT


miR-378

CTCCTGACTCCAGGTCCTGTGT


miR-485-5p

AGAGGCTGGCCGTGATGAATTC


Poly (T) adapter

GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTWN


Reverse RACE

GCGAGCACAGAATTAATACGAC


ETS1F

CCAGACAGACACCTTGCAGA


ETS1R

TGAGGCGATCACAACTATCG


KLF13F

GAAGCACAAGTGCCACTACG


KLF13R

GGCAGCTGAACTTCTTCTCG


NFIBF

AGCTGCTGGAAGTCGAACAT


NFIBR

TGAAGGTGGAGGTGGAGTTC


LIN28BF

AAGGCCTTGAGTCAATACGG


LIN28BR

CACTTCTTTGGCTGAGGAGG


SH2B3F

CTGGAGCTCTTCGACCCAC


SH2B3R

ATGTCTGTCCGGTCCTTCAC


ACCN2F

AGCTGTTACCATGGACTCGG


ACCN2R

CACGCAGTACTCCTGGTCCT



in situ probes


Name

Sequence (enhanced with LNA) 5'-3'


mmu-miR-124

GGCATTCACCGCGTGCCTTA


mmu-miR-34a

AACAACCAGCTAAGACACTGCCA


mmu-miR-128

AAAAGAGACCGGTTCACTGTGA


mmu-miR-125b-5p

TCACAAGTTAGGGTCTCAGGGA


mmu-miR-378

CCTTCTGACTCCAAGTCCAGT


mmu-miR-122

CAAACACCATTGTCACACTCCA


Scrambled-miR

TTCACAATGCGTTATCGGATGT


Oligonucleotide primers and in situ probes from the miRCURY™LNA Detection system (Exiqon, Vedbaek, Denmark).

Arora et al. BMC Developmental Biology 2010 10:1   doi:10.1186/1471-213X-10-1

Open Data