Table 2

Primers used in this study.

Primer

Sequence

Purpose


SDC1for

ATGAGACGCGCGGCGCTC

RTPCR

SDC1rev

GGCGTAGAACTCCTCCTGC

RTPCR

SDC2for

GCCTTGATGGCCTGTGTGTC

RTPCR

SDC2rev

GCATAAAACTCCTTAGTGGG

RTPCR

SDC3for

CGTGGCTGACGTAAGGACC

RTPCR

SDC3rev

CTCTAGTATGCTCTTCTGAA

RTPCR

SDC4for

CGAGAGACAGAGGTCATCGAC

RTPCR

SDC4rev

TGCGTAGAACTCATTGGTGG

RTPCR

bactfor

ATGGATGACGATATCGCTGCG

RTPCR

bactrev

CTAGAAGCATTTGCGGTGCAC

RTPCR

SDC2ecoRIfor

TATATAGAATTCGTAGGAGCCACATCCCTG

SDC2 cloning

SDC2ecoRIrev

TATATAGAATTCTTATGCATAAAACTCCTTAGTGG

SDC2 cloning

SDC4ecoRIfor

TATATAGAATTCGACTGGTTTGCGCTGTTGAA

SDC4 cloning

SDC4ecoRIrev

TATATAGAATTCTCATGCGTAGAACTCATTGGT

SDC4 cloning

IRESdelfor

GATATCCGCTAGCGCTACCGGACT

Deletion of CMV promoter from pIRES2-EGFP

IRESdelrev

ATGCATGGCGGTAATACGGT

Deletion of CMV promoter from pIRES2-EGFP

GFPfor

TATATAAAGCTTGCCACCATGGTGAGCAAG

GFP cloning

GFPrev

TATATAGGATCCATGATCTAGAGTCGCGGCC

GFP cloning


Alexopoulou et al. BMC Cell Biology 2008 9:2   doi:10.1186/1471-2121-9-2

Open Data