Table 2

Real time PCR primer pairs

Primer*

Sequence (5'→3')

Amplicon Size (bp)


18 S For

GGACCAGAGCGAAAGCATTTGCC

18 S Rev

TCAATCTCGGGTGGCTGAACGC

50

AAH For

GGGAGATTTTATTTCCACCTGGG

AAH Rev

CCTTTGGCTTTATCCATCACTGC

256

Humbug For

GCTGGGTTGATTGAGGATGTGTG

Humbug Rev

GCAGGGGGAAAAAGTCACCTTATC

301

Junctin For

CCTGAGTCAAGGAAGGAAAGTAAG

Junctin Rev

GCCGTTTCTTTTCTGGGTATTTCC

308

IRS-1 For

TGCTGGGGGTTTGGAGAATG

IRS-1 Rev

GGCACTGTTTGAAGTCCTTGACC

68

IRS-2 For

AAAATTGGCGGAGCAAGGC

IRS-2 Rev

ATGTTCAGGCAGCAGTCGAGAG

64

IRS-4 For

CCGACACCTCATTGCTCTTTTC

IRS-4 Rev

TTTCCTGCTCCGACTCGTTCTC

74


*For-forward; Rev-reverse; AAH = aspartyl (asparaginyl)-β-hydroxylase; IRS = insulin receptor substrate

Lahousse et al. BMC Cell Biology 2006 7:41   doi:10.1186/1471-2121-7-41

Open Data