Table 1

List of all the primer sequences used for qRT-PCR analysis
Gene Primer sequence 5′- 3′ Size
18S rRNA F- GGAGAGGGAGCCTGAGAAAC 171 bp
R - CCTCCAATGGATCCTCGTTA
BMI1 F - ACGATGCCCAGCAGCAATGACT 172 bp
R- AAGTGGACCATTCCTTCTCCAGGT
CBX2 F- GAGTACCTGGTCAAGTGGCG 215 bp
R- TCGGGTTCCTTGAGCTTGGA
CERBERUS F - GTGCCCTTCAGCCAGACTATAACC 107 bp
R - TGCGCGGCTCCAGGAAAATG
CXCR4 F - GGCAGCAGGTAGCAAAGTGACGC 334 bp
R - AGAGGAGGTCGGCCACTGACA
E CADHERIN F- CACTGGGCTGGACCGAGAGAGTT 236 bp
R- ACGCTGGGGTATTGGGGGCA
EED F – TGCCATTGTGTGCTGGAAACCTGG 163 bp
R - GCCCAATGCAAGCATCTTTTGCC
EOMESODERMIN F - TTCTGGCTTCCGTGCCCACG 103 bp
R - CATGCGCCTGCCCTGTTTCGTA
EZH2 F- ACACGGGGATAGAGAATGTGGGTT 455 bp
R -TCCGCTTATAAGTGTTGGGTGTTGC
FOXA2 F - AGGAGGAAAACGGGAAAGAA 134 bp
R - CAACAACAGCAATGGAGGAG
HAND1 F- TGCCTGAGAAAGAGAACCAG 273 bp
R- ATGGCAGGATGAACAAACAC
HNF4A F - CCCAGCCCCCTAAGAGAGCAC 245 bp
R - CCCAGCCCCCTAAGAGAGCAC
JARID2 F – TGCACAAGCCGCAGGACTCG 356 bp
R - ACAGCCCCCTATGAGCGGGAG
MAP2 F- GCATGAGCTCTTGGCAGG 192 bp
R - CCAATTGAACCCATGTAAAGCC
MIXL F - AGTCCAGGATCCAGGTATGGTTCC 192 bp
R- CAACCCCGTTTGGTTCGGGC
N CADHERIN F - AACTGGGCCAGGAGCTGACCA 122 bp
R- GTGCCCTCAAATGAAACCGGGCT
NANOG F - AGTCCCAAAGGCAAACAACCCACTTC 164 bp
R- TGCTGGAGGCTGAGGTATTTCTGTCTC
NKX6.1 F- CAGAGAGTCAGGTCAAGGTCTGGT 260 bp
R– CTCGGACGCGTGCAGTAGGA
OCT4A F - AGCCCTCATTTCACCAGGCC 448 bp
R- TGGGACTCCTCCGGGTTTTG
P19 F- TTGCAGGCCGCCAGTG 289 bp
R- GGGTGTCCAGGAATCCAGTG
PDX1 F- GAAAGGCCAGTGGGCAGGCGG 137 bp
R- GGCGCGGCCGTGAGATGTAC
REX1 F- GGCAAACCCACCCCACTCACC 146 bp
R- CAAACACCTGCTGGACTGTGAGC
RING1A F- AGCCCTACGGAGCGGGAACA 258 bp
R- GGTATCGGCCGCCTCACACG
RING1B F- CCATGAACAGACTGCAGCGA 125 bp
R- ACTAGGGCCTGCTTCCTGAT
SOX17 F - AAGGGCGAGTCCCGTATC 221 bp
R- TTGTAGTTGGGGTGGTCCTG
SOX2 F- GGGGGAAAGTAGTTTGCTGCCTCT 135 bp
R- TGCCGCCGCCGATGATTGTT
SOX9 F- GACGCTGGGCAAGCTCTGGAGACTT 141 bp
R- TTCTTCACCGACTTCCTCCGCCG
SUZ12 F- CTGTGGAGGGGGTGGCAGTTAC 144 bp
R- AGGCCTGGAGGAAAAGCTCGTG

Pethe et al.

Pethe et al. BMC Cell Biology 2014 15:18   doi:10.1186/1471-2121-15-18

Open Data