Table 3

Primer sequences, annealing temperatures of primer sets (°C), expected PCR fragment sizes (bp) and accession numbers or references
Primer name Primers sequence Annealing temperature (°C) PCR product (bp) Accession number or reference
ACTB CACGCCATCCTGCGTCTGGA AGCACCGTGTTGGCGTAGAG 63 100 [24]
B2MI CAAGATAGTTAAGTGGGATCGAGAC TGGTAACATCAATACGATTTCTGA 58 161 [24]
GAPDH CTTCACGACCATGGAGAAGG CCAAGCAGTTGGTGGTACAG 63 170 AF017079
HMBS-2 AGGATGGGCAACTCTACCTG GATGGTGGCCTGCATAGTCT 58 83 [24]
HPRT-1 GGACTTGAATCATGTTTGTG CAGATGTTTCCAAACTCAAC 60 91 [24]
KRT 8 TGACCGACGAGATCAACTTC TGATGTTCCGGTTCATCTCC 60 294 NM_001159615
MUC1 TAAAGAAGACGGGCTTCTGG CCGCTTTAAGCCGATCAAAC 60 134 XM_001926883
MUC2 ACCCGCACTACGTCACCTTC GGCAGGACACCTGGTCATTG 62 150 BX671371
MUC4 CTGCTCTTGGGCACTATATG CCTGTGACTGCAGAATCAAC 60 133 DQ848681
OCLN CTACATAATGGGCGTCAACC GGGCTGCTCGTCATAAATAC 60 298 NM_001163647
RPL-19 AACTCCCGTCAGCAGATCC AGTACCCTTCCGCTTACCG 60 147 [25]
SDHA CTACAAGGGGCAGGTTCTGA AAGACAACGAGGTCCAGGAG 58 141 [24]
TBP-1 AACAGTTCAGTAGTTATGAGCCAGA AGATGTTCTCAAACGCTTCG 60 153 [24]
VIL1 AGAAGTGGACGGTGCCCAAC TCTCGCCGATGAGGTAGGTG 64 273 XM_001925167
ZO-1/TJP1 GAGGGCATTTCCCACGTTTC GCTTTAGAGCCGAGTCCTTG 62 256 XM_003353439

Reference genes are underlined.

Delgado-Ortega et al.

Delgado-Ortega et al. BMC Cell Biology 2014 15:14   doi:10.1186/1471-2121-15-14

Open Data