Table 1

Primer pairs used in the real-time PCR experiments of gene expression profiles Primer pairs applied for real-time PCR

Gene

Accession

Sense primer

Antisense primer

Product


bTERT

NM001046242

TCACGGGTCAAGACGCTGT

CGGGCATAACTGGAGTGGT

886 bp

p16INK4a

XM868375

GGTGATGATGATGGGCAGCG

ACCAGCGTGTCCTGGAAGC

134 bp

p53

NM174201

CGGAACACCTTTAGACACAGT

GTAGGCAGTGCTCGCTTAGT

304 bp

p21Cip1

NM001098958

TCTACCACTCCAAACGCA

GCAAAGGATGAAGAGGGTT

331 bp

TRPS-1

NM014112*

GCCTTCTTTGAGTTCGGA

CCCTCTGCTGTTTGTTGAG

384 bp

Bcl-2

XM586976

GCCTTCTTTGAGTTCGGA

TTCAGAGACAGCCAGGAGA

209 bp

Bax

NM173894

AGTGGCGGCTGAAATGTT

TTCTTCCAGATGGTGAGCG

287 bp

Bag-1

NM001076291

TGCCATTGTCAGCACTTG

TGTTCTGTTCCACTGTGTCAC

376 bp

c-Myc

AF519455

GTGTCTACCCATCAGCACAA

AACTGTTCTCGCCTCTTCTG

376 bp

DNMT1

NM182651

CCCGAGTGTGGAAAGTGTA

GAACATCTGCCCATTGCT

392 bp


*TRPS-1 primer pairs were designed by comparing homologous sequences between the Homo sapiens and Bos taurus genome, because the cattle TRPS-1 sequence has not been reported.

All other primer sequences were cited from GenBank. Each pairs of primers span intron-extron boundaries.

Zhao et al. BMC Cell Biology 2010 11:82   doi:10.1186/1471-2121-11-82

Open Data