Table 1

Oligonucleotide primer sets used in quantitative real-time PCR experiments

Gene

Primer Sequence (5'-3')

Product Size (bp)


γ-globin

GCAGCTTGTCACAGTGCAGTTC

TGGCAAGAAGGTGCTGACTTC

166

β-globin

GTCTACCCTTGGACCCAGAGGTTC

TGAGCCAGGCCATCACTAAAG

131

ε-globin

CAGCTGCAATCACTAGCAAGC

AGACGACAGGTTTCCAAAGC

190

α-globin

GGTCAACTTCAAGCTCCTAAGC

GCTCACAGAAGCCAGGAACTTG

116

ζ-globin

TGAGCGAGCTGCACGCCTAC

GTACTTCTCGGTCAGGACAGA

173

CTDSPL2

TGGAACGTCAGGATCAGATTCTC

GATGGTCTCACTTGAACTGCTTGA

157

GAPDH

TCAACGACCACTTTGTCAAGCTCA

GCTGGTGGTCCAGGGGTCTTACT

119


Ma et al. BMC Cell Biology 2010 11:75   doi:10.1186/1471-2121-11-75

Open Data