Table 1

Deleted MAL2 yeast two-hybrid constructs, primer sequences and MAL2 regions deleted

Construct

PCR Primer Sequences (5'-3')

MAL2 region deleted


pAS2-1MAL2ΔN

pACT2MAL2ΔN

CATGCCATGGCCTACTCGGGCGCCTTCGTC

CCGCTCGAGTTACGGTCGCCATCTTCGTAA

amino acids

1–34


pAS2-1MAL2

ΔNTM1

CCGGAATTCTCCTCCAATGTTCCTCTACC

CCGCTCGAGTTACGGTCGCCATCTTCGTAA

amino acids

1–55


pAS2-1MAL2

ΔNTM12

CCGGAATTCCTCTCTGGAATGGTGGCT

CCGCTCGAGTTACGGTCGCCATCTTCGTAA

amino acids

1–86


pAS2-1MAL2

ΔNTM123

CCGGAATTCGAAGCAGCAGCCACATCC

CCGCTCGAGTTACGGTCGCCATCTTCGTAA

amino acids

1–119


pAS2-1MAL2

ΔNTM1234

CCGGAATTCGCTTTACGAAGATGGCGACCG

CCGCTCGAGTTACGGTCGCCATCTTCGTAA

amino acids

1–169


Fanayan et al. BMC Cell Biology 2009 10:7   doi:10.1186/1471-2121-10-7

Open Data