Table 1

Primers for RT-PCR and real-time RT-PCR

Target

gene

Forward sequence (5'-3')

Reverse sequence (5'-3')

AS (bp)

AT (°C)

GA


TLR3

GGTGGTCCCGTTAATTTCCT

CCCGAAAACATCCTTCTCAA

240

56

NM_126166

TLR7

TGGAAATTTTGGACCTCAGC

TTGCAAAGAAAGCGATTGTG

262

52

NM_133211

TLR9

TGCAGGAGCTGAACATGAAC

TAGAAGCAGGGGTGCTCAGT

297

58

NM_031178

β-actin

GCTACAGCTTCACCACCACAG

GGTCTTTACGGATGTCAACGTC

288

60

NM_007393


AS = amplicon size; AT = annealing temperature; GA = genbank accession

Yang et al. BMC Cell Biology 2009 10:37   doi:10.1186/1471-2121-10-37

Open Data