Table 1

Primer sequences and PCR amplification conditions

Gene

Primers (5'→3')

Annealing temperature (°C)

Cycles

Product size(bp)


CYP1A1

S: CCATGTCGGCCACGGAGTT

59

32

174

A: ACAGTGCCAGGTGCGGGTT

MMP-9

S: CAACATCACCTATTGGATCC

52.5

37

480

A: CGGGTGTAGAGTCTCTCGCT

c-Jun

S: TCAGACAGTGCCCGAGAT

55.2

30

292

A: CTGCGTTAGCATGAGTTGG

Beta-actin

S: CTCGCTGTCCACCTTCCA

52

30

256

A: GCTGTCACCTTCACCGTTC


Abbreviations: S, sense primer; A, antisense primer

Peng et al. BMC Cell Biology 2009 10:27   doi:10.1186/1471-2121-10-27

Open Data