Table 3

Genes and primer sequences for qRT-PCR.

Gene

GenBank

Primer sequences

Fold change (diabetic vs. normal)


GSH-ST

J03914

Forward: GATGTCCTTGATCAACACCG

Reverse: GGCCGCTCTTCATGTAGTCAG

5.47

MHC

x04267

Forward: GTCAAGTCCTACAAGAGGCAGG

Reverse: GATTCTGCAATATCCGCACG

4.78

Metallothionein 1 and 2

M11794

Forward: CTGCGGCTGCAAGAACTG

Reverse: CTTGTCCGAGGCACCTTTG

7.21

HMGCoAS

M33648

Forward: CTGCCCAAACGTCTAGACTCC

Reverse: GAAGAGGTTGCTTGTGTCACC

6.2

ALS

03190

Forward: GCTTATGAGGCAGATGCTAATGG

Reverse: ATGCCTGGTCATCAACTCATC

-2.96

PHAS-1

U05014

Forward: ACTAGCCCTACCAGCGATGAG

Reverse: TGTCCATCTCAAACTGTGACTC

2.64

DiEcoAR

D00569

Forward: TGCAGTGATTATGCCTCTTGG

Reverse: CTTCGATTACATCCCACTCCTC

2.58

CPT-1

L07736

Forward: TTGTCTACGAGCCAGACTCCTC

Reverse: AGGAGACACCATAGCCGTCATC

2.42

RAD

U12187

Forward: CATCCTAGTGGGCAACAAGAG

Reverse: AGGTCTCGATGAACTTGCAGTC

1.53

CK

X59736

Forward: CTGGTCGCTACTACAAGCTGTC

Reverse: CCCAGCGCATGTTAGTAAAGG

-3.93

β-2-microglobulin

Y00441

Forward: CCACCGAGACCGATGTATATG

Reverse: CGGATCTGGAGTTAAACTGGTC


In the order the genes are glutathione S-transferase, embryonic skeletal muscle myosin heavy chain, metallothionein-1 and 2, mitochondrial 3-hydroxy-3methylglutaryl-CoA synthase, 5-aminolevulinate synthase, PHAS-I protein, 2,4-dienoyl-CoA reductase, carnitine palmitoyltransferase I, Ras-related protein, and sarcomeric mitochondrial creatine kinase.

Hu and Willsky BMC Bioinformatics 2006 7:12   doi:10.1186/1471-2105-7-12

Open Data