BMC Biochemistry

unofficial impact factor 1.84

Open Access Research article

The intein of the Thermoplasma A-ATPase A subunit: Structure, evolution and expression in E. coli

Alireza G Senejani1, Elena Hilario2 and J Peter Gogarten3*

Author Affiliations

1 Department of Molecular and Cell Biology, University of Connecticut, Storrs, CT 06269-3044, USA

2 Current address: HortResearch, 120 Mt Albert Road, Private Bag 92, 169 Mt Albert, Auckland, New Zealand

3 Department of Molecular and Cell Biology, University of Connecticut, 75 North Eagleville Rd. Storrs, CT 06269-3044, USA

For all author emails, please log on.

BMC Biochemistry 2001, 2:13 doi:10.1186/1471-2091-2-13


The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2091/2/13


Received:17 October 2001
Accepted:14 November 2001
Published:14 November 2001

© 2001 Senejani et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.

Abstract

Background

Inteins are selfish genetic elements that excise themselves from the host protein during post translational processing, and religate the host protein with a peptide bond. In addition to this splicing activity, most reported inteins also contain an endonuclease domain that is important in intein propagation.

Results

The gene encoding the Thermoplasma acidophilum A-ATPase catalytic subunit A is the only one in the entire T. acidophilum genome that has been identified to contain an intein. This intein is inserted in the same position as the inteins found in the ATPase A-subunits encoding gene in Pyrococcus abyssi, P. furiosus and P. horikoshii and is found 20 amino acids upstream of the intein in the homologous vma-1 gene in Saccharomyces cerevisiae. In contrast to the other inteins in catalytic ATPase subunits, the T. acidophilum intein does not contain an endonuclease domain.

T. acidophilum has different codon usage frequencies as compared to Escherichia coli. Initially, the low abundance of rare tRNAs prevented expression of the T. acidophilum A-ATPase A subunit in E. coli. Using a strain of E. coli that expresses additional tRNAs for rare codons, the T. acidophilum A-ATPase A subunit was successfully expressed in E. coli.

Conclusions

Despite differences in pH and temperature between the E. coli and the T. acidophilum cytoplasms, the T. acidophilum intein retains efficient self-splicing activity when expressed in E. coli. The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase. Phylogenetic analyses suggest that this intein was horizontally transferred between Pyrococcus and Thermoplasma, and that the small intein has persisted in Thermoplasma apparently without homing.

Background

During the last decade several genes have been found to be interrupted by selfish genetic elements translated in frame with their host proteins. During post translational processing these elements excise themselves out of the host protein (see [1] and [2] for recent reviews). The sequences removed during splicing are called inteins (short for internal protein); the portions of the host protein are termed exteins (external protein) [3-5].

Inteins facilitate their excision out of the host protein without the help of any known host specific activity. This phenomenon, called protein splicing, was first discovered about a decade ago in the Saccharomyces cerevisiae V-ATPase catalytic subunit A [6,7]. Intein excision depends on the splicing domain of the intein and the first amino acid residue of the C-extein [8]. The inteins known to date are between 134 and 608 amino acids long, and they have been reported from all three domains of life: eukaryotes, eubacteria and archaea. Pietrokovski's webpage on inteins http://blocks.fhcrc.org/~pietro/inteins/ webcite currently lists more than 100 inteins in 34 different types of proteins [9]. The host proteins are diverse in function, including metabolic enzymes, DNA and RNA polymerases, gyrases, proteases, ribonucleotide reductases, and vacuolar and archaeal type ATPases. Common features suggested for these proteins are their expression during DNA replication [1] and their low substitution rate during evolution [9].

Most reported inteins are composed of two domains: one is responsible for protein splicing, and the other has endonuclease activity [10-13]. The function of the endonuclease is to spread the intein to intein-free homologs of the host protein. During this process, called homing, the gene encoding the intein-free homolog is cleaved by the endonuclease at or close to the intein integration site. During the repair of the cleaved gene, the intein is copied to the previously intein-free homolog. Gimble and Thorner [14] demonstrated intein homing in Saccharomyces cerevisiae using engineered V-ATPase genes from which the intein encoding portion had been previously removed. However, some inteins lack the endonuclease domain. Inteins without this domain perform autocatalytic splicing [15,16]. Homing endonucleases and the process of homing have been more intensively studied in self splicing introns [17], and the process is assumed to be similar for inteins.

Thermoplasma acidophilum is among sixteen archaea for which inteins have been reported to date (Intein database http://www.neb.com/inteins/int_reg.html webcite[18]). Members of the genus Thermoplasma lack cell walls and possess a cytoskeleton. They live in hot and acidic environments, and are often found adhering to sulfur particles [19]. T. acidophilum grows optimally at 59°C and at an external pH between 1–2 [20]. A cytoplasmic pH of 5.5 has been measured indirectly [21].

Proton pumping ATPases/ATPsynthases are found in all groups of present day organisms [22]. The typical archaeal ATPsynthase is homologous to the eukaryotic vacuolar ATPase. Because of the high degree of sequence similarity the archaeal ATP synthase (A-type ATPase) is sometimes labeled as vacuolar or V-type ATPase. The archaeal and the vacuolar ATPase are both homologous to the bacterial F-ATPases, but the level of sequence similarity with the F-ATPases is much lower than between the V- and the A-ATPases. To date seven species have been identified to harbor inteins in their ATPase catalytic subunits. The first intein was discovered in the vma-1 gene of Saccharomyces[7]. The yeast Candida tropicalis[23] possesses an intein in the same location. Inteins are also present in the A subunit of the A-type ATPases of Thermoplasma acidophilum, T. volcanium, Pyrococcus abysii, P. horikoshii and P. furiosus.

Here we present data on the cloning and expression of the T. acidophilum A-ATPase A subunit in E. coli, and we discuss implications for the location, propagation and distribution of inteins among organisms.

Results

Sequence analysis of the T. acidophilum intein

The T. acidophilum intein was discovered while sequencing the catalytic subunit of the archaeal ATPase/ATPsynthase from T. acidophilum for systematic purposes [24]. More recently, the complete genome sequences of T. acidophilum[25] and T. volcanii[26] have been reported. In both instances, the catalytic subunit of the ATPsynthase is the only gene in the entire genome for which an intein was reported. Using PSI-BLAST [27] with different inteins as seeds, divergent inteins with less than ten percent sequence identity as compared to the query sequence are recovered (data not shown); however, using this approach we did not discover any additional intein or homing endonuclease encoding genes in T. acidophilum.

Multiple sequence alignments of diverse intein sequences identified eight motifs composed of moderately conserved residues [18,28]. The A-ATPase A subunit of the Thermoplasma and Pyrococcus intein multiple sequence alignment (with manual modification) is shown in figure 1. The T. acidophilum intein (173 amino acids long) is among the shortest inteins known, and the alignment with other inteins reveals the absence of sequences homologous to the typical endonuclease motifs. Only the motifs characteristic for the self splicing domain are present in the Thermoplasma intein (see figure 1).

thumbnailFigure 1. Alignment of archaeal ATPase A-subunit intein sequences. The large gap in the Thermoplasma sequences indicates that the Thermoplasma acidophilum (Tac) and Thermoplasma volcanium (Tvo) inteins do not contain an endonuclease domain and only consist only of the self splicing domain, while the Pyrococcus abyssi (Pab), P. furiosus (Pfu) and P. horikoshii (Pho) A-ATPase A-subunits inteins are bifunctional. Regions corresponding to conserved blocks [18] are indicated in bold and labeled A-H. Blocks A, B, F and G are part of the splicing domain, whereas blocks C, D, E, H are typical for endonucleases of the LAGDIDAG type [18].

The significance of the match between the T. acidophilum and the three pyrococcal ATPase inteins was assessed using PRSS at http://fasta.bioch.virginia.edu/fasta/prss.htm webcite[29]. The P-value for this match, i.e. the probability of obtaining a match of this quality by chance alone, was calculated to be below 10-10. This indicates that not only the exteins, but also the inteins themselves are recognizably homologous. In contrast, a sequence alignment of all known inteins shows intein sequences to be much more divergent (not shown). For example, the P-value for the comparison between the T. acidophilum and the Saccharomyces cerevisiae intein was 0.28, i.e. no significant similarity between the yeast and the Thermoplasma inteins was detectable using pairwise alignments only.

Location of the intein within the host protein

The vacuolar and the archaeal ATPases are homologous to the bacterial and organellar F-type ATPases. The structure of the bovine mitochondrial F1-ATPase has been determined by X-ray crystallography [30]. The intein insertion points in the yeasts' V-ATPase and the Thermoplasma and Pyrococcus A-ATPases correspond to the catalytic site where the ATP binds and is hydrolyzed during the catalytic cycle. Figure 2 shows that the inteins are located in the regions of these very conserved proteins [22] that have the lowest substitution rates.

thumbnailFigure 2. Divergence along the archaeal and vacuolar ATPase A subunits. The diagram depicts the number of substitutions per site calculated for a sliding window of 10 amino acid residues along an alignment of 62 vacuolar and archaeal ATPase catalytic subunits. The ordinate gives the number of substitutions observed in each position in the alignment. Arrows indicate the locations of the inteins. The first (A) gives the location of the inteins in Thermoplasma and Pyrococcus, the second (B) gives the location in the yeasts' vacuolar ATPases.

Comparison of A-ATPase catalytic subunit and 16S rRNA phylogeny

The phylogenies of archaeal ATPase catalytic subunits and small subunit ribosomal RNAs are shown in Figure 3. Both phylogenies were calculated for a similar set of species. While the two phylogenies show some significant differences, neither of them groups the molecules from Thermoplasma with the Pyrococcus homologs. In both phylogenies several other Archaea, i.e., M. jannaschii, M. thermolithotrophicus, Thermococcus sp., Halobacterium sp., Methanosarcina and Methanobacterium thermoautotrophicus branch off between the two groups that carry inteins in their ATPase catalytic subunits. All of these intervening archaeal ATPases do not carry an intein.

thumbnailFigure 3. Comparison of vacuolar/archaeal ATPase A subunit and small subunit ribosomal RNA phylogenies. The phylogeny depicted in (A) was calculated from the extein portions of the genes only; (B) was calculated from small subunit ribosomal RNAs. The trees were calculated as unrooted, but are depicted as rooted using the eukaryotes as an outgroup to the Archaea (A), or the Crenarchaeota as an outgroup to the Euryarchaeota (B). Numbers give bootstrap values calculated from 100 bootstrapped samples analyzed using parsimony analysis. Values are only given for groups with more than 50% support. Asterisks denote branches that in the maximum likelihood evaluation were not at least 3 or 2 times larger, respectively, than their estimated standard error. All other branches were at least three times larger than their standard deviation. See experimental procedures for further details on the phylogenetic reconstruction methods used. Species whose A-subunit contains an intein are indicated by arrows.

Codon usage comparison

Codon usage varies among organisms. The production of tRNAs corresponds to the frequencies with which the different codons are present in their protein coding genes. The exact causes for tRNA regulation and codon usage are not completely understood; however, expression of foreign genes in an organism is often prevented by a different codon usage of the foreign gene [31]. Many Archaea have codon usage frequencies and tRNA compositions different from E. coli. The T. acidophilum A-ATPase A subunit has 763 codons. Codon AUA (Ile) is the most frequent (39/1000). In E. coli the same codon (AUA) is a rare codon present at a frequency of only 5.5 per 1000. The other two major differences in codon usage between the T. acidophilum A-ATPase A subunit and E. coli are AGG (Arg) and AGA (Arg) which are present in T. acidophilum A-ATPase A subunit at frequencies of 41 and 16 per 1000 respectively. In E. coli however, these codons are considered rare and occur with frequencies of 1.7 and 2.8 per 1000 respectively.

Expression and intein splicing of T. acidophilum A-ATPase A subunit

The gene encoding the T. acidophilum A-ATPase A subunit was cloned into the expression vector pET-11a (Stratagene) and transformed into E. coli Bl21(DE3) and E. coli Bl21-CodonPlus(DE3)-RIL strain for protein expression. When E. coli Bl21(DE3), a strain that did not express additional rare tRNAs, was transformed with the cloned T. acidophilum ATPase A subunit, no additional protein bands were observed in extracts of induced cells (not shown). However, the E. coli Bl21-CodonPlus (DE3)-RIL strain transformed with the same plasmid expresses two additional proteins of 20 and 65 kDalton upon induction (Fig. 4). No additional band at 85 kDa, indicative of an unprocessed intein, was visible after induction. This demonstrates that autocatalytic splicing occurred efficiently in E. coli. Efficient autocatalytic splicing was also observed when the E. coli were grown and induced at 42°C, or when the E. coli were induced at 16°C for 16 hours (Fig. 4A). During preparation for SDS gel electrophoreses the samples are heated to 72°C in the presence of DTT. With respect to temperature these conditions are more similar to the conditions in the T. acidophilum cytoplasm than the conditions in E. coli. Intein excision might occur only during this high temperature treatment. Therefore, proteins from induced E. coli were also separated under non-denaturing conditions with or without addition of DTT. The induced bands were excised from the non-denaturating gel and separated using denaturing SDS gel electrophoresis (Fig. 5). Both of the slower migrating bands visible after induction (A and B in Fig. 5), revealed only one major band corresponding to the spliced and religated A-subunit upon separation in an SDS denaturing gel. Presumably the slower migrating band was a dimer or higher aggregate of the A-subunit monomer. In none of these experiments did we find any indications for unprocessed or incompletely spliced inteins.

thumbnailFigure 4. SDS polyacrylamide gel electrophoresis of proteins from induced E. coli. Panel A, Lanes 1 and 3: E. coli Bl21-CodonPlus(DE3)-RIL strain transformed with empty pET-11a vector (negative control); lanes 2, 4, 5 and 6: E. coli Bl21-CodonPlus(DE3)-RIL strain transformed with the Thermoplasma A-ATPase cloned into pET-11a; lane 1-4: cells were induced for 4 hours; lane 5: cells were induced at 16°C for 16 hours; lane 6: cells were induced at 42°C for 2 hours; Sup.: supernatant. Panel B depicts the splicing process schematically. The unprocessed T. acidophilum A-ATPase A subunit has a calculated size of 85 kDalton. The expected molecular weight of the intein is 20 kDalton, and the religated host protein weighs approximately 65 kDalton.

thumbnailFigure 5. Non-denaturing polyacrylamide gel electrophoresis of proteins from induced E. coli. Lanes 1 and 2: non-denaturing polyacrylamide gel electrophoresis of proteins from the supernatant of the cell lysate. Arrows point towards bands that are present in induced E. coli transformed with the Thermoplasma A-ATPase, but absent in the negative control. The sample buffer did not contain DTT or SDS. Lanes 3, 4, 5 and 6 are separations in denaturing SDS polyacrylamide gels. Lane 3: electro-eluted protein from lane 2 (arrow A); lane 4: electro-eluted protein from lane 2 (arrow B); lanes 1 and 5: E. coli Bl21-CodonPlus(DE3)-RIL strain transformed with empty pET-11a vector (negative control); lanes 2 and 6: E. coli Bl21-CodonPlus(DE3)-RIL strain transformed with the Thermoplasma A-ATPase cloned into pET-11a and induced for 8 hours at 37°C.

Discussion

The Daucus carota[32] and Saccharomyces cerevisiae (Alireza Senejani unpublished) catalytic V-ATPase subunits form inclusion bodies when expressed in E. coli. In contrast, the T. acidophilum subunit is expressed as a soluble protein in the E. coli cytoplasm. Despite the chemical and physical differences between the E. coli cytoplasm and the environment in which the T. acidophilum intein is functioning in vivo, we found no indications that self-splicing of the intein was inefficient in E. coli. Even when E. coli was grown at lower temperatures, processing of the intein and religation of the exteins appeared 100% efficient. Complete processing was also observed when the E. coli proteins were separated in non-denaturing and non-reducing gels. Autocatalytic splicing of the T. acidophilum A-ATPase catalytic subunit occurs efficiently in the E. coli cytoplasm. The T. acidophilum A-ATPase intein appears to splice out efficiently at very different pHs (7.2 versus 5.5 [21,33]) and temperatures (16 to 37° versus 55°C [20]).

The T. acidophilum intein shows significant sequence similarity to the inteins found in the A-ATPase catalytic subunits of Pyrococcus. Moreover, these inteins are inserted into the same highly conserved sequence in the ATP binding site. This indicates that the inteins in Thermoplasma and Pyrococcus are homologous in the evolutionary sense, i.e., they are derived from a common ancestral gene. However, Pyrococcus and Thermoplasma are not considered closely related Archaea. Based on their 16S rRNA they are considered distantly related Euryarchaeotes (See Fig. 3b).

One explanation for the discrepancy between phylogenetic classification and distribution of the A-ATPase intein is horizontal gene transfer: the intein was not present in the last common ancestor of Thermoplasma and Pyrococcus, rather the intein invaded one of the lineages after their split and was more recently horizontally transferred to the other lineage. The horizontal transfer scenario is more parsimonious than the assumption of presence in the shared common ancestor because the latter requires several independently occurring losses of the intein together with its long-term persistence in the Pyrococcus and Thermoplasma lineages (cf. Fig. 3b). Horizontal transfer of whole genes and operons between divergent species is a frequent event [34-37]. Even house keeping genes are transferred between divergent species [37].

Two possibilities exist for the horizontal transfer scenario. Either the whole A-ATPase catalytic subunits was transferred, or the intein alone spread as a selfish genetic element. To discriminate between these two scenarios, we constructed the phylogeny of the host protein (Fig. 3a). The resulting phylogeny is in reasonable agreement with the ribosomal rRNA phylogeny, the main exception being the placement of Desulfurococcus. According to its 16S rRNA this organisms is clearly classified as a Crenarcheote; however, its ATPase catalytic subunit groups with Thermococcus sp. The finding that the host protein itself does not group the genus Thermoplasma with the Pyrococci suggests that the intein alone was transferred between Thermoplasma and Pyrococcus, and that the sequence similarity between the Thermoplasma and Pyrococcus catalytic subunits was sufficient to allow homing into the same insertion site.

The dispersion of the intein as a selfish genetic element is consistent with the work of Goddard and Burt [38] on the persistence of an intron with homing endonuclease in yeast mitochondria. These authors studied the distribution of empty target sites, and introns with and without a functioning endonuclease gene among different yeasts. They concluded that the long term persistence of the intron depends on a cycle that begins with invasion of the empty target site by an intron with the help of a homing endonuclease encoded by an open reading frame within the intron. However, once the intron containing allele is fixed in the population, the endonuclease, which itself had been the reason for the rapid spread of the intron in the population, is no longer under selection, the endonuclease becomes non-functional and is lost, resulting in an intron without homing endonuclease activity. However, once the endonuclease is lost the intron containing allele becomes more likely to be replaced with an allele that has lost the intron altogether and the cycle of invasion and successive loss begins anew.

The process of intein homing is likely to depend on a similar cycle; however, the time intervals for loss of the intein are likely to be longer than the loss of the intron. The A-ATPase and the V-ATPase inteins are located in the most conserved part of the host gene. Any deletion of the intein from the gene itself needs to be precise, because any alteration of the amino acid sequence in the catalytic site is likely to result in a non-functioning enzyme. Comparative sequence analysis (Fig. 1) shows that the T. acidophilum and T. volcanium inteins do not contain an endonuclease domain. Our search of the genomes of these Archaea did not identify any endonucleases that might function in homing. While the failure to identify a homing endonuclease is not proof of absence, the presence of a homing endonuclease acting in trans would be unprecedented and has to be regarded as improbable. The cyclic reinvasion model for long term persistence of a selfish genetic element through homing [38] suggests that the small Thermoplasma intein evolved through reduction from a large endonuclease containing intein similar to the one found in the pyrococcal A-ATPase. Apparently, the small intein has been persisting in the Thermoplasma A-ATPase since the split between T. acidophilum and T. volcanium without the help of a homing endonuclease.

The cyclic reinvasion model also explains why the insertion site is in a region of very low substitution rates: The high degree of sequence similarity surrounding the integration point facilitates the intein transfer between different populations and species using the homing endonuclease. A more variable sequence surrounding the integration point would restrict homing to members of the same species, and would thus lower the chances for long term survival of the intein.

Conclusion

The small intein in the Thermoplasma A-ATPase is closely related to the endonuclease containing intein in the Pyrococcus A-ATPase. Phylogenies constructed with the host protein (A-ATPase catalytic subunit) and with 16S rRNA do not group these two organisms together, suggesting that the A-ATPase intein spread through horizontal gene transfer. The small intein has persisted in Thermoplasma apparently without homing. The T. acidophilum intein retains efficient self-splicing activity when expressed in E. coli. This activity does not depend on the physicochemical conditions in the T. acidophilum cytoplasm.

Materials and Methods

Thermoplasma acidophilum cultures were obtained from Denis Searcy at the University of Massachusetts in Amherst. Organisms were grown and their DNA isolated as described [39]. DNA manipulation, sequencing and cloning followed standard procedures as described in Sambrook et al. [40] and Ausubel et al. [41].

Plasmid constructs

The T. acidophilum A-ATPase A subunit encoding gene was amplified from genomic DNA using primers Ta-4 (ATGGATCCTTCTCAACGAAGAGCAGTG) and Ta-5 (GAGGTGAACATATGGGAAAGATAATCAG). These primers match the coding sequence of the Thermoplasma acidophilum A-ATPase A subunit (gene identification number 9369337) and introduce restriction sites useful in subcloning. Initially, the PCR product was cloned into pCRR 2.1 (TA cloning Vector, Invitrogen). After digestion with NdeI and BamHI the coding sequence was subcloned to the vector pET-11a (Stratagene) for gene expression experiments.

Protein expression and determination

E. coli Bl21(DE3) and Bl21-CodonPlus(DE3)-RIL strain (Stratagene) were used for protein expression. If not stated otherwise, transformed E. coli were grown overnight in a culture wheel at 37°C in Luria-Bertani broth with ampicillin (100 μg/mL). One mL of the broth was used to inoculate 10 mL of LB broth containing ampicillin and incubated at 37°C (200 rpm). After 2 hours, isopropyl thio-β-D-galactoside (IPTG) was added to a final concentration of 1 mM to induce gene expression and the cultures. Cells were harvested 4 hours after induction by centrifugation at 7000 rpm for 10 min and washed with TEP buffer (0.1 M Tris-HCl, pH 7.4, 0.01 M EDTA and 1 mM phenyl methyl sulfonyl fluoride). Cells were resuspended in 500 μL of TEP buffer and sonicated with a Braun-Sonic U with micro-tip for 4 minutes (0.5 duty cycle; power output approximately 120). The disrupted cells were centrifuged at 8000 rpm and the pellet was resuspended in 500 μL of fresh TEP buffer. Both the supernatant and the pellet were diluted by adding 6X sample buffer (10% SDS, 1.2 mg/mL bromphenol blue, 0.6 M DTT, 30% glycerol, .1 M Tris/HCl pH 6.8) and heated to 80°C for 15 minutes to denature the protein. Five to fifty microliters of this preparation were run in a 10% denaturing Tris/Tricine SDS polyacrylamide gel electrophoresis system as described by Schagger and von Jagow [42].

Non-denatured protein was prepared with the same procedure except that SDS was omitted from the buffers and that the samples were not heated. Proteins were electroeluted from the non-denaturing gel as describe here [24]. Gels were fixed with fixing solution (50% methanol, 10% acetic acid) for 15 minutes, followed by staining in Coomassie staining solution (20% acetic acid, 0.025% Coomassie blue G-250) for one hour, followed by destaining in destaining solution (5% methanol, 10% acetic acid) [42].

DNA sequencing and cloning

DNA was sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing (PE Applied Biosystems). Sequencing gels were ran and processed in the Biotech Center (University of Connecticut)

Codon usage

The program Codon Usage Tabulated from GenBank (CUTG) at http://www.kazusa.or.jp/codon/ webcite[43] was used to calculate the codon usage of individual genes and genomes.

Sequence retrieval, alignment and phylogenetic reconstruction

The Pyrococcus furiosus A-ATPase sequence was retrieved via blastp from the unfinished genome using the web page http://combdna.umbi.umd.edu/bags.html webcite. The aligned small subunit ribosomal RNA sequences were retrieved from the Ribosomal Database Project II http://rdp.cme.msu.edu webcite[44]. Francine Perler (New England Biolabs) the curator of the intein database http://www.neb.com/inteins/int_reg.html webcite kindly provided the sequences of all known inteins. All the other sequences were retrieved from the NCBI databank.

Sequences were aligned using CLUSTAL X 1.8 [45]. The number of substitutions per site in the aligned data set were calculated using a JAVA program written by Olga Zhaxybayeva (University of Connecticut). This program calculates and plots the number of substitutions in a sliding window of 10 aligned positions. The window is moved through the alignment one position at a time. For positions where less than 50% of the sequences have a gap, the average number of substitutions was calculated considering the gap as an additional character. Positions with gaps in more than 50% of the aligned sequences were skipped.

Phylogenies were reconstructed from amino acid sequences aligned using CLUSTAL X 1.8 [45]. The topologies of the depicted trees were calculated using neighbor joining as implemented in CLUSTAL X with correction for multiple substitutions. Branch lengths and their confidence intervals were calculated with TREE-PUZZLE 5.0 [46] using the JTT or the HKY model for substitution respectively, and assuming an among site rate variation described by a gamma distribution. Bootstrap samples were analyzed using parsimony as implemented in PAUP* 4.0 beta 8 [47] treating gaps as missing data. Each bootstrapped sample was analyzed using 10 different starting trees built through random addition, tree-branch-reconnection (TBR) branch swapping, and considering gaps as missing data. The following sequences were used for the 16S rRNA phylogeny (the sequences are available under these names from the Ribosomal Database Project II http://rdp.cme.msu.edu/ webcite : Sul.solfa4, Sul.acalda, Ap.pernixl, Mc.thlitho, Mc.janrrnA, Mb.tautot2, Pc.furios2, Pc.abyssi, AP000001, AB016298, Tpl.acidop, Arg.fulgid p, Hf.volcani, Hb.spCh2_2, Hb.salina2, Msr.mazei5, Msr.barke2, Dco.mobili.

Acknowledgements

The research was supported in part through the NASA Exobiology Program. The authors thank Torsten Schadtle for help with DNA sequencing, Ryan Murphy for constructing a Thermoplasma acidophilum genomic library, Olga Zhaxybayeva for providing computer programs, Lorraine Olendzenski for reading the manuscript and assistance with experimental procedures, and Denis Searcy for help with culturing Thermoplasma acidophilum. A.S. thanks the Mannheim University of Applied Sciences and the University of Connecticut for support through fellowships.

References

  1. Liu XQ: Protein-splicing intein: Genetic mobility, origin, and evolution.

    Annu Rev Genet 2000, 34:61-76. PubMed Abstract | Publisher Full Text OpenURL

  2. Paulus H: Protein splicing and related forms of protein autoprocessing.

    Annu Rev Biochem 2000, 69:447-496. PubMed Abstract | Publisher Full Text OpenURL

  3. Dujon B: Group I introns as mobile genetic elements: facts and mechanistic speculations – a review.

    Gene 1989, 82:91-114. PubMed Abstract | Publisher Full Text OpenURL

  4. Perler FB, Davis EO, Dean GE, Gimble FS, Jack WE, Neff N, Noren CJ, Thorner J, Belfort M: Protein splicing elements: inteins and exteins – a definition of terms and recommended nomenclature.

    Nucleic Acids Res 1994, 22:1125-1127. PubMed Abstract | PubMed Central Full Text OpenURL

  5. Cooper AA, Stevens TH: Protein splicing: self-splicing of genetically mobile elements at the protein level.

    Trends Biochem Sci 1995, 20:351-356. PubMed Abstract | Publisher Full Text OpenURL

  6. Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y: Molecular structure of a gene, VMA1, encoding the catalytic subunit of H(+)-translocating adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae.

    J Biol Chem 1990, 265:6726-6733. PubMed Abstract | Publisher Full Text OpenURL

  7. Kane PM, Yamashiro CT, Wolczyk DF, Neff N, Goebl M, Stevens TH: Protein splicing converts the yeast TFP1 gene product to the 69-kD subunit of the vacuolar H(+)-adenosine triphosphatase.

    Science 1990, 250:651-657. PubMed Abstract OpenURL

  8. Chen L, Benner J, Perler FB: Protein splicing in the absence of an intein penultimate histidine.

    J Biol Chem 2000. OpenURL

  9. Pietrokovski S: Intein spread and extinction in evolution.

    Trends Genet 2001, 17:465-472. PubMed Abstract | Publisher Full Text OpenURL

  10. Pietrokovski S: Modular organization of inteins and C-terminal autocatalytic domains.

    Protein Sci 1998, 7:64-71. PubMed Abstract | Publisher Full Text OpenURL

  11. Perler FB, Olsen GJ, Adam E: Compilation and analysis of intein sequences.

    Nucleic Acids Res 1997, 25:1087-1093. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  12. Dalgaard JZ, Moser MJ, Hughey R, Mian IS: Statistical modeling, phylogenetic analysis and structure prediction of a protein splicing domain common to inteins and hedgehog proteins.

    J Comput Biol 1997, 4:193-214. PubMed Abstract OpenURL

  13. Duan X, Gimble FS, Quiocho FA: Crystal structure of PI-SceI, a homing endonuclease with protein splicing activity.

    Cell 1997, 89:555-564. PubMed Abstract | Publisher Full Text OpenURL

  14. Gimble FS, Thorner J: Homing of a DNA endonuclease gene by meiotic gene conversion in Saccharomyces cerevisiae.

    Nature 1992, 357:301-306. PubMed Abstract | Publisher Full Text OpenURL

  15. Chong S, Xu MQ: Protein splicing of the Saccharomyces cerevisiae VMA intein without the endonuclease motifs.

    J Biol Chem 1997, 272:15587-15590. PubMed Abstract | Publisher Full Text OpenURL

  16. Derbyshire V, Wood DW, Wu W, Dansereau JT, Dalgaard JZ, Belfort M: Genetic definition of a protein-splicing domain: functional mini-inteins support structure predictions and a model for intein evolution [published erratum appears in Proc Natl Acad Sci USA 1998 Jan 20;95(2):762].

    Proc Natl Acad Sci U S A 1997, 94:11466-11471. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  17. Jurica MS, Stoddard BL: Homing endonucleases: structure, function and evolution.

    Cell Mol Life Sci 1999, 55:1304-1326. PubMed Abstract | Publisher Full Text OpenURL

  18. Perler FB: InBase, the Intein Database.

    Nucleic Acids Res 2000, 28:344-345. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  19. Searcy DG, Stein DB, Green GR: Phylogenetic affinities between eukaryotic cells and a thermophilic mycoplasma.

    Biosystems 1978, 10:19-28. PubMed Abstract | Publisher Full Text OpenURL

  20. Darland G, Brock TD, Samsonoff W, Conti SF: A thermophilic, acidophilic mycoplasma isolated from a coal refuse pile.

    Science 1970, 170:1416-1418. PubMed Abstract OpenURL

  21. Searcy DG: Thermoplasma acidophilum: intracellular pH and potassium concentration.

    Biochim Biophys Acta 1976, 451:278-286. PubMed Abstract | Publisher Full Text OpenURL

  22. Gogarten JP, Starke T, Kibak H, Fishman J, Taiz L: Evolution and isoforms of V-ATPase subunits.

    J Exp Biol 1992, 172:137-147. PubMed Abstract OpenURL

  23. Gu HH, Xu J, Gallagher M, Dean GE: Peptide splicing in the vacuolar ATPase subunit A from Candida tropicalis.

    J Biol Chem 1993, 268:7372-7381. PubMed Abstract | Publisher Full Text OpenURL

  24. Hilario E: The vacuolar H+-ATPase from Giardia lamblia: a potential model for the study of the evolution of the first eukaryotes.

    University of Connecticut, Storrs, CT 1998. OpenURL

  25. Ruepp A, Graml W, Santos-Martinez ML, Koretke KK, Volker C, Mewes HW, Frishman D, Stocker S, Lupas AN, Baumeister W: The genome sequence of the thermoacidophilic scavenger Thermoplasma acidophilum.

    Nature 2000, 407:508-513. PubMed Abstract | Publisher Full Text OpenURL

  26. Kawashima T, Amano N, Koike H, Makino S, Higuchi S, Kawashima-Ohya Y, Watanabe K, Yamazaki M, Kanehori K, Kawamoto T, Nunoshiba T, Yamamoto Y, Aramaki H, Makino K, Suzuki M: Archaeal adaptation to higher temperatures revealed by genomic sequence of Thermoplasma volcanium.

    Proc Natl Acad Sci USA 2000, 97:14257-14262. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  27. Schaffer AA, Aravind L, Madden TL, Shavirin S, Spouge JL, Wolf YI, Koonin EV, Altschul SF: Improving the accuracy of PSI-BLAST protein database searches with composition-based statistics and other refinements.

    Nucleic Acids Res 2001, 29:2994-3005. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  28. Pietrokovski S: Conserved sequence features of inteins (protein introns) and their use in identifying new inteins and related proteins.

    Protein Sci 1994, 3:2340-2350. PubMed Abstract | Publisher Full Text OpenURL

  29. Pearson WR: Empirical statistical estimates for sequence similarity searches.

    J Mol Biol 1998, 276:71-84. PubMed Abstract | Publisher Full Text OpenURL

  30. Abrahams JP, Leslie AG, Lutter R, Walker JE: Structure at 2.8 A resolution of F1-ATPase from bovine heart mitochondria.

    Nature 1994, 370:621-628. PubMed Abstract | Publisher Full Text OpenURL

  31. Makrides SC: Strategies for achieving high-level expression of genes in Escherichia coli.

    Microbiol Rev 1996, 60:512-538. PubMed Abstract | PubMed Central Full Text OpenURL

  32. Zimniak L, Dittrich P, Gogarten JP, Kibak H, Taiz L: The cDNA sequence of the 69-kDa subunit of the carrot vacuolar H+- ATPase. Homology to the beta-chain of F0F1-ATPases.

    J Biol Chem 1988, 263:9102-9112. PubMed Abstract | Publisher Full Text OpenURL

  33. Padan E, Zilberstein D, Rottenberg H: The proton electrochemical gradient in Escherichia coli cells.

    Eur J Biochem 1976, 63:533-541. PubMed Abstract | Publisher Full Text OpenURL

  34. Doolittle WF: Lateral genomics.

    Trends Cell Biol 1999, 9:M5-8. PubMed Abstract | Publisher Full Text OpenURL

  35. Gogarten JP, Olendzenski L: Orthologs, paralogs and genome comparisons.

    Curr Opin Genet Dev 1999, 9:630-636. PubMed Abstract | Publisher Full Text OpenURL

  36. Lawrence JG: Gene transfer, speciation, and the evolution of bacterial genomes.

    Curr Opin Microbiol 1999, 2:519-523. PubMed Abstract | Publisher Full Text OpenURL

  37. Olendzenski L, Liu L, Zhaxybayeva O, Murphey R, Shin DG, Gogarten JP: Horizontal transfer of archaeal genes into the deinococcaceae: detection by molecular and computer-based approaches.

    J Mol Evol 2000, 51:587-599. PubMed Abstract | Publisher Full Text OpenURL

  38. Goddard MR, Burt A: Recurrent invasion and extinction of a selfish gene.

    Proc Natl Acad Sci USA 1999, 96:13880-13885. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  39. Searcy DG: Thermophiles: Culture of Thermoplasma acidophilum.

    Amherst, MA: Biology Dept., Univ. of Massachusetts, available through the author 1993. OpenURL

  40. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual,.

    Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 1989. OpenURL

  41. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K: Current Protocols in Molecular Biology.

    John Wiley and Sons Inc 2000. OpenURL

  42. Schagger H, von Jagow G: Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.

    Anal Biochem 1987, 166:368-379. PubMed Abstract | Publisher Full Text OpenURL

  43. Nakamura Y, Gojobori T, Ikemura T: Codon usage tabulated from international DNA sequence databases: status for the year 2000.

    Nucleic Acids Res 2000, 28:292. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  44. Maidak BL, Cole JR, Lilburn TG, Parker CT Jr, Saxman PR, Farris RJ, Garrity GM, Olsen GJ, Schmidt TM, Tiedje JM: The RDP-II (Ribosomal Database Project).

    Nucleic Acids Res 2001, 29:173-174. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  45. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

    Nucleic Acids Res 1997, 25:4876-4882. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL

  46. Strimmer K, von Haeseler A: Quartet puzzling: A quartet maximum-likelihood method for reconstructing tree topologies.

    Molecular Biology and Evolution 1996, 964-969. OpenURL

  47. Swofford D: PAUP* 4.0 beta version, Phylogenetic Analysis Using Parsimony (and Other Methods):.

    Sinauer Associates, Inc., Sunderland, MA, USA 1998. OpenURL