Table 1

Methylation assay target sequences
Assay ID Genomic target sequence Bisulfite converted target sequence Pyrosequencing dispensation order
ADS2502FS1 caggcggaatccgccctctggccaaaggactagcgtaccagg taggyggaattygttttttggttaaaggattagygtattagg ATCATGTCGTATCGTCTGCTAGACTATGTCGTA
ADS2502FS1 ccacgccccacgtctcatgcggcagcggcagacgccccggcccgtcgatccgccccttccgccgcttcgcctcggccaatcaacgagcgcccgcgcccccatcCCCATCCCGTGGAGTGGCCGGCGACAAGATGG (c>g, polymorphism rs1264014) ttaygtttttaygttttatgyggtagyggtagaygtttyggttygtygtattygtttttttygtygt/gttygtttyggttaattaaygagygagygttygygttttattTTTATTTYGTGGAGTGGTYGGYGATAAGATGG TCGATCGTCTGATCGTCTATAGTCGTCATGTCGTAGTATCAGTTCGTCAGTCGTCGATCGTTCAGTCGTTCTGTTCGTCATCGATCGATGTCAGTCGTCGTCTATTGATTCGTGAGTAGTCGTCGA

Yang et al.

Yang et al. BMC Biochemistry 2013 14:17   doi:10.1186/1471-2091-14-17

Open Data