Mapping of the minimal inorganic phosphate transporting unit of human PiT2 suggests a structure universal to PiT-related proteins from all kingdoms of life
-
* Corresponding author: Lene Pedersen LP@mb.au.dk
1 Department of Molecular Biology, Aarhus University, C. F. Møllers Allé 3, Aarhus C, DK-8000, Denmark
2 Institute of Clinical Medicine, Aarhus University, Brendstrupgårdsvej 100, Aarhus N, DK-8200, Denmark
3 Department of Haematology, Aarhus University Hospital, Tage-Hansens gade 2, DK-8000 Aarhus C, Denmark
4 Department of Medical Biochemistry, Ole Worms Allé 3, Aarhus University, DK-8000 Aarhus C, Denmark
BMC Biochemistry 2011, 12:21 doi:10.1186/1471-2091-12-21
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2091/12/21
| Received: | 7 January 2011 |
| Accepted: | 17 May 2011 |
| Published: | 17 May 2011 |
© 2011 Bøttger and Pedersen; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
The inorganic (Pi) phosphate transporter (PiT) family comprises known and putative Na+- or H+-dependent Pi-transporting proteins with representatives from all kingdoms. The mammalian members are placed in the outer cell membranes and suggested to supply cells with Pi to maintain house-keeping functions. Alignment of protein sequences representing PiT family members from all kingdoms reveals the presence of conserved amino acids and that bacterial phosphate permeases and putative phosphate permeases from archaea lack substantial parts of the protein sequence when compared to the mammalian PiT family members. Besides being Na+-dependent Pi (NaPi) transporters, the mammalian PiT paralogs, PiT1 and PiT2, also are receptors for gamma-retroviruses. We have here exploited the dual-function of PiT1 and PiT2 to study the structure-function relationship of PiT proteins.
Results
We show that the human PiT2 histidine, H502, and the human PiT1 glutamate, E70, - both conserved in eukaryotic PiT family members - are critical for Pi transport function. Noticeably, human PiT2 H502 is located in the C-terminal PiT family signature sequence, and human PiT1 E70 is located in ProDom domains characteristic for all PiT family members.
A human PiT2 truncation mutant, which consists of the predicted 10 transmembrane (TM) domain backbone without a large intracellular domain (human PiT2ΔR254-V483), was found to be a fully functional Pi transporter. Further truncation of the human PiT2 protein by additional removal of two predicted TM domains together with the large intracellular domain created a mutant that resembles a bacterial phosphate permease and an archaeal putative phosphate permease. This human PiT2 truncation mutant (human PiT2ΔL183-V483) did also support Pi transport albeit at very low levels.
Conclusions
The results suggest that the overall structure of the Pi-transporting unit of the PiT family proteins has remained unchanged during evolution. Moreover, in combination, our studies of the gene structure of the human PiT1 and PiT2 genes (SLC20A1 and SLC20A2, respectively) and alignment of protein sequences of PiT family members from all kingdoms, along with the studies of the dual functions of the human PiT paralogs show that these proteins are excellent as models for studying the evolution of a protein's structure-function relationship.
Background
Phosphate is needed by any living cell for structural and metabolic purposes. Inorganic phosphate (Pi) has to be actively transported across the cell membrane against a chemical and electrical gradient. In mammalian cells this task is managed by the type III sodium-dependent Pi (NaPi) symporters, PiT1 and PiT2, which utilize the free energy provided by the Na+ concentration gradient as the driving force for uphill import of Pi[1-3], reviewed in [4].
The mammalian type III transporters are part of the Pi transport (PiT) family (SLC20 [5]; TC #2.A.20 [6]), but several members were originally identified as receptors for different retroviruses belonging to the gamma-retrovirus genus [7-13]; thus, PiT1 and PiT2 are proteins with dual functions. The PiT family also comprises non-mammalian members, e.g., fungus Pho-4+ (Neurospora crassa (N. crassa)) [14] and yeast Pho89 (Saccharomyces cerevisiae (S. cerevisiae)) [15] as well as the proton (H+)-dependent Pi transporters from bacteria, PiTA and PiTB (Escherichia coli (E. coli)) [16], and plant Pht2_1 (Arabidopsis thaliana (A. thaliana)) [17]. Furthermore, there is an increasing number of entries in the National Center for Biotechnology Information (NCBI) protein database (URL: http://www.ncbi.nlm.nih.gov/ webcite) that show similarity to the known members of the PiT family and therefore are denoted putative phosphate permeases; and PiT family members have been found in all kingdoms [18], reviewed in [19]. Altogether, this suggests that the PiT proteins developed very early in evolution and that this family of proteins has important function(s) in all kingdoms of life.
The first membrane topology model of PiT proteins was based on Kyte-Doolittle hydropathy plots. Analyses of human PiT1 and Pho-4+ protein sequences predicted 10 transmembrane (TM) domains, 9 loops (here referred to as L1 to L9) hereof 5 extracellular, internal N- and C-terminal ends, and a large hydrophilic domain (L6) intracellularly positioned between the putative 6th and 7th TM domains [20]. Due to profound similarity (approx. 62% amino acid identity) between the human PiT paralogs, the same membrane topology model was proposed to also apply for human PiT2 (Figure 1) [8]. The model was, moreover, supported by the experimental assignment of the large intracellular domain of rat PiT2 to the cytoplasmic space [21]. Other topology models have, however, been proposed for PiT1 [22,23] and PiT2 [24] (Figure 2); please see legend to Figure 2 for more details. Nevertheless, we have shown that exchanging as little as 12 or 15 amino acids in the fungal PiT protein, Pho-4+, with human PiT1 or human PiT2 sequences, respectively, results in proteins that support infection by human PiT1 or PiT2 cognate gamma-retroviruses [25,26]; results, which suggest that these transporters are structurally highly related.
Figure 1. Putative topological model of human PiT2 and mutants. Putative membrane topology model of human PiT2 on which the mutant proteins investigated
in the present paper are based; the model was originally proposed by O'Hara and coworkers
[8,20]. The numbers of the TMs are indicated above the model. Other membrane topology models
have been proposed for PiT1 [22,23] and PiT2 [24], which suggested diverging topology for the two paralogs; the alternative PiT2 model
is shown in Figure 2. The amino acids previously identified in human PiT2 as being critical for Pi transport function are highlighted with black filling and pointed out with arrows;
D28, E55, S113, D506, E575, and S593[18,27,28]. In human PiT1, the amino acids S128 (PiT2 S113) and S621 (PiT2 S593) have previously been identified as being critical for PiT1 Pi transport function [29]. In the present study, human PiT2 H502 (situated in the PiT family signature sequence) and human PiT1 E70 (equivalent in position to human PiT2 E55) are also identified as critical for Pi transport function (see Figure 3). The grey-filled sequences (L11-L161 and V492-V640), represent the N- and C-terminal, respectively, ProDom domains (PD001131) published
in 2004 defining the PiT family members [27]. The dark grey-filed sequence (I53-L127) represents the most recent ProDom domain defining the PiT family members http://prodom.prabi.fr/ webcite.
Figure 2. Alternative topological model of human PiT2 and mutants. Membrane topology model for human PiT2 suggested by Salaün and coworkers [24]; the TMs are shown as grey-filled sequences and their numbers are indicated with
roman numbers above the model. This model shares some similarity to a membrane topology
model for PiT1 proposed in 2002 [22]. Based on the cellular location of C-terminal tags, the C-terminal ends of PiT1 and
PiT2 were predicted to be extracellular [22,24]. And based on the cellular location of an N-terminal tag on PiT2 and glycosylation
of a site in human PiT1 and partly glycosylation of the same site in human PiT2 although
oddly not in hamster PiT2, the N-termini of PiT1 and PiT2 were suggested to be extracellular
[22,24]; due to a suggested additional TM after TM3 in Figure 1 (TMIV in this figure), this did not influence the orientation of the large intracellular
domain in these models compared to the model in Figure 1. The PiT2 model shown in Figure 1 and this figure, respectively, and the PiT1 model proposed in 2002 [22] were later compared by us [18]. In 2009, Farrell and coworkers proposed a modified model of human PiT1 based on
substituted cysteine accessibility mutagenesis [23]. The recent model of PiT1 shows more resemblance to the PiT2 models shown in this
figure and in Figure 1 concerning the length and position of the large intracellular domain (L6) than the
model from 2002. The amino acids identified in human PiT2 and human PiT1 as being
critical for Pi transport function are highlighted with black filling and pointed out with arrows;
for references see legend to Figure 1. Compared to the PiT2 model in Figure 1, the PiT2 model proposed by Salaün and coworkers (this figure) and the PiT1 model
proposed in 2009 by Farrell and coworkers do not affect the placement of PiT1 D43 (PiT2 D28), PiT1 E70 (PiT2 E55), PiT1 H530 (PiT2 H502), PiT1 D534 (PiT2 D506), PiT1 E603 (PiT2 E575), and PiT1 S621 (PiT2 S593) in either a TM domain or a loop sequence [23,24] (compare Figure 1 and this figure). However, PiT1 S128 (PiT2 S113) placed in loop regions in the PiT2 models (this figure and Figure 1), is in the PiT1 model from 2009 suggested to be placed in a TM domain [23].
Analyzing human PiT1 and Pho-4+ sequences, Johann and coworkers discovered an internal sequence repeat, which they suggested had originated from an ancient gene duplication [20]. Both regions were shown to harbor a ProDom domain, PD001131 (Figure 1) [27] (human PiT2 I11-L161 and V492-V640), characteristic for all members of the PiT family. Interestingly, all amino acids in human PiT2 (i.e. D28, E55, S113, D506, E575, and S593) and in human PiT1 (S128 and S621) identified to be critical for Pi transport function are located in these ProDom domains (Figure 1) [18,27-29]. It should be noted, that, the ProDom domain PD001131 has changed and now consists of what corresponds to human PiT2 I53-L127 http://prodom.prabi.fr webcite (Figure 1). In an attempt to narrow down a PiT family trait, Saier aligned the N-terminal protein sequences from 17 members representing all kingdoms [6,30]. The author noted the existence of an 11-amino-acid-long sequence in the N-terminal region containing the conserved core sequence [GANDVANA] and proposed it to be a signature sequence for the PiT family [6,30]. However, refined studies of the N- and C-termini of 109 protein sequences representing PiT family members from all kingdoms revealed that these proteins harbor a 12-amino-acid-long PiT family signature sequence - with the common core consensus sequence [GANDVANA] - within each of the PD001131 ProDom domains proposed in 2004 [18]. Furthermore, D28 and D506 shown to be critical for PiT2 Pi transport are placed in either of the PiT family signature sequences [18].
To further investigate the importance of the PiT family signature sequences, we have analyzed the human PiT2 histidine, H502, located in the C-terminal PiT family signature sequence, and we show that it is indeed critical for the Pi transport function but dispensable for infection by PiT2 cognate gamma-retroviruses. The human PiT2 H502 is the second amino acid in this sequence to be identified as critical for Pi transport function. In addition, we also show that the human PiT1 glutamate, E70, located in the PD001131 ProDom domain, is critical for the Pi transport function but dispensable for infection by PiT1 cognate gamma-retroviruses.
We have, moreover, combined studies of the gene structure of the human PiT genes (SLC20A1 and SLC20A2), alignment and TM domain prediction of protein sequences of PiT family members from all kingdoms of life, and studies of the dual functions of the human PiT paralogs as Pi transporters and gamma-retroviral receptors, and we found that these proteins are excellent as models for studying the evolution of protein structure-function relationship. Specifically based on the observation that bacterial and archaeal PiT family members are substantially smaller than eukaryotic members [18] and our alignment (Additional File 1 Figure A), we analyzed truncation mutants of human PiT2. Our results clearly show that the large intracellular domain of human PiT2 is dispensable for Pi transport function, and that a fully functional Pi-transporting unit can be created by the 10 TM domains and the small loop sequences connecting them (human PiT2ΔR254-V483). A further truncated human PiT2 protein with the 5th and 6th TM domains and the large intracellular domain removed resembles the structures of as well a putative phosphate permease from archaea as of PiTA from bacteria (Archaeoglobus fulgidus (A. fulgidus) and E. coli, respectively). This mutant (human PiT2ΔL183-V483) was an excellent gamma-retroviral receptor [31], and we here show that it can support low levels of Pi transport. Altogether, these results suggest that the overall structure of the Pi-transporting unit of the PiT family proteins has remained unchanged during evolution.
Additional file 1. Protein sequence alignment of nine PiT family members from all kingdoms. A The 10 putative TM domains according to the Johann topology model are shown on the human PiT2 sequence using black boxes with white filling [8,20]; the putative large intracellular domain (L6) of human PiT2, according to this model, spans the amino acid sequence: P236-V483. The N-terminal and C-terminal PiT family signature sequences [18] are shown on the alignment in black boxes with grey filling. Human PiT1 E70 in the 2nd TM domain and human PiT2 H502 in the 7th TM domain are indicated with circles. The TMHMM-predicted TM domains of the eukaryotic protein sequences for PiT family members and the DAS-predicted TM domains of the prokaryotic protein sequences for PiT family members are shown in black bold. The red bold sequences represent TM-domains, which we suggest exist, however, they were not predicted by the servers: N. crassa Pho-4+ TM 1 (sequence Q5-I24) is suggested to be homologous to the TM 1 predicted in the C. elegans putative phosphate permease protein sequence. The presence of Pho-4+ TM 1 is also based on the assumption that the N-terminal PiT-family signature sequences should be placed equivalently (extracellularly in L1) in all PiT family members. A. thaliana Pht2_1 TM 2 (sequence A187-G211) is suggested to be homologous to the TM 2 predicted in the T. brucei putative phosphate permease protein sequence. The presence of Pht2_1 TM 2 is also based on experimental assignment of the L6 for rat PiT2 to the cytoplasmic space [21], and Pht2_1 therefore requires a TM 2 to fulfill this criteria. H. sapiens PiT2 TM 3 (sequence T83-A105) is suggested to be homologous to the TM 3 predicted in the H. sapiens PiT1 protein sequence. Investigation of a human PiT1/PiT2 chimera where the PiT1 backbone harbors the human PiT2 sequence G120-V141 showed that this sequence conferred A-MLV receptor function upon human PiT1 [48], and the G120-V141 sequence is therefore highly likely extracellular in both human PiT paralogs and this requires the presence of TM 3 in human PiT2. TM 7 domains in putative phosphate permeases from C. elegans (sequence Q330-A349), D. melanogaster (sequence M472-G491), T. brucei (sequence Y346-A365), and N. crassa Pho-4+ (sequence Y318-A337) are suggested to be homologous to the TM 7 predicted in H. sapiens PiT2 and PiT1 sequences. The presence of TM 7 in putative phosphate permeases from C. elegans, D. melanogaster, T. brucei, and N. crassa Pho-4+ is also based on the assumption that the C-terminal PiT-family signature sequences should be placed equivalently (extracellularly in L7) in all PiT family members. Moreover, investigation of a Pho-4+/human PiT2 chimera where the Pho-4+ backbone harbors the human PiT2 sequences C117-I143 (stretch in L3) and L512-A531 (stretch in L7) showed that these sequences confer A-MLV receptor function upon Pho-4+[26], and these sequences are therefore highly likely extracellular and this requires the presence of a TM 7. Similarly, investigation of a Pho-4+/human PiT1 chimera where the Pho-4+ backbone harbors the human PiT1 sequence L545-S556 (stretch in L7) showed that these sequences confer GALV receptor function upon Pho-4+[25]. H. sapiens PiT2 TM 9 (sequence G571-S593) and H. sapiens PiT1 TM 9 (sequence G599-S521) are suggested to be homologous to the TM 9 predicted in RPHO-1 R. norvegicus (human PiT1 ortholog) protein sequence G601-S623 [Swiss-Prot:Q9JJP0] using the TMHMM server (data not shown). N. crassa Pho-4+ TM 9 (sequence L523-G545) is suggested to be homologous to the TM 9 predicted in C. elegans putative phosphate permease protein sequence. The TM 9 is required to orient the TM 10 equivalently in all PiT family members. Lower case letters represent TMHMM- or DAS-predicted TM sequences, which we based on either too small length to comprise a TM or due to suggested extracellular position (see above) found were non-compatible with regular TM domains; however, these sequences might instead "dip" into the membrane lipid bilayer. It should be noted that these sequences are counted as being part of the loop sequences in Figure 4. A star (✰) (labeled a to i) and a vertical line indicate the position of an intron-exon border in each of the human PiT genes determined by use of the SPIDEY mRNA-to-genome DNA alignment as described in "Methods". Below the alignment, the names, species, phylas, kingdoms, Swiss-Prot accession numbers, and the amino acid lengths of the nine proteins are given. B The server-predicted TM domains (black boxes) and the by us suggested TM domains (red boxes) for each of the nine PiT family members are depicted in order to illustrate the conservedness of the TM domains: TM 4, TM 8, TM 10 (fully conserved) > TM 5, TM 6 (fully conserved in eukaryotes) > TM 1, TM 2, TM 3 > TM 9 > TM 7 (least conserved). The white asterisk indicates a prediction of a unique TM domain in the unusually long N-terminal sequence of A. thaliana Pht2_1.
Format: PDF Size: 155KB Download file
This file can be viewed with: Adobe Acrobat Reader
Methods
Sequence alignment
Protein sequence alignment of nine PiT family members representing all kingdoms was made using the ClustalW alignment program version 2.0.12 available at the European Bioinformatics Institute server (URL: http://www.ebi.ac.uk/clustalw2/ webcite) [32]. The Swiss-Prot protein sequences were retrieved from the NCBI Protein server (URL: http://www.ncbi.nlm.nih.gov/protein/ webcite). Accession numbers are: Homo sapiens (H. sapiens) PiT2 [Swiss-Prot:Q08357], H. sapiens PiT1 [Swiss-Prot:Q08344], Caenhorabditis elegans (C. elegans) putative phosphate permease [Swiss-Prot:Q17455], Drosophila melanogaster (D. melanogaster) putative phosphate permease [Swiss-Prot:Q9VTG0], N. crassa Pho-4+ [Swiss-Prot:P15710], Trypanosoma brucei (T. brucei) putative phosphate permease [Swiss-Prot:Q9N930], A. fulgidus putative phosphate permease [Swiss-Prot:O29467], A. thaliana Pht2_1 [Swiss-Prot:Q38954], and E. coli PiTA [Swiss-Prot:P37308]. All sequences encompass two 12-amino-acid-long sequences, which based on comparison of 109 sequences, were identified in PiT proteins and related proteins and suggested to be PiT family signature sequences [18]. We, however, observed that the C-terminal PiT family signature sequence of E. coli PiTA did not group together with the C-terminal PiT family signature sequences of the eight other species in the alignment (data not shown). In order to group all the C-terminal PiT family signature sequences together, the alignment was adjusted manually after an alignment of H. sapiens PiT2 amino acids S422-V652 [Swiss-Prot:Q08357], A. fulgidus putative phosphate permease [Swiss-Prot:O29467], and E. coli PiTA [Swiss-Prot:P37308]. For the adjusted protein sequence alignment of the PiT family members, see Additional File 1 Figure A.
Prediction of TM domains in the PiT family members and related proteins
Putative TM domains were predicted using the TMHMM Server v. 2.0 available at the Center for Biological Sequence Analysis, Technical University of Denmark (URL: http://www.cbs.dtu.dk/services/TMHMM/ webcite), and the Dense Alignment Surface (DAS) Transmembrane Prediction server available at the Stockholm Bioinformatics Center, Stockholm University (URL: http://www.sbc.su.se/~miklos/DAS/ webcite). TMHMM is based on a hidden Markov model (HMM) that is cyclic with seven types of states for helix core, helix caps on either side, loop on the cytoplasmic side, two loops for the non-cytoplasmic side, and a globular domain state in the middle of each loop [33], and DAS is based on low-stringency dot-plots of the query sequence against a collection of non-homologous membrane proteins using a previously derived special scoring matrix [34].
In general, the predictions using both servers correspond well to each other when compared (data not shown), however, the DAS server tends to predict shorter TM domains in agreement with the tendency for prokaryotic TM domains to be shorter in length when compared to the length of eukaryotic TM domains [35]. Therefore, we chose to use the DAS server over the TMHMM server when predicting TM domains in the prokaryotic protein sequences for E. coli PiTA and A. fulgidus putative phosphate permease. The predicted TM domains are shown in Additional File 1 Figure A.
Intron-exon border analysis of human PiT genes SLC20A1 and SLC20A2
The SPIDEY mRNA-to-genome DNA alignment program version 1.40 available from the NCBI homepage (URL: http://www.ncbi.nlm.nih.gov/spidey/index.html webcite) [36] was used to determine the location of intron-exon borders in the human PiT genes. SPIDEY takes as input an mRNA sequence and the corresponding genomic sequence, and it generates an alignment that establishes the gene structure. The GenBank mRNA sequences were retrieved from the NCBI nucleotide server (http://www.ncbi.nlm.nih.gov/nuccore/ webcite). Accession numbers are: H. sapiens PiT1 mRNA [GenBank:NM_005415] and H. sapiens PiT2 mRNA [GenBank:NM_006749]. The genomic GenBank sequences were retrieved from the NCBI human genome server (http://www.ncbi.nlm.nih.gov/projects/genome/guide/human/ webcite). Accession numbers are: H. sapiens chromosome 2 (SLC20A1) [GenBank:NC_000002] and H. sapiens chromosome 8 (SLC20A2) [GenBank:NC_000008]. The intron-exon borders are shown in Additional File 1 Figure A on the protein sequence alignment of nine PiT family members.
Expression plasmids
The pcDNA1ARtkpA-derived expression plasmids pOJ74 and pOJ75 (Wyeth-Ayerst Research, Pearl River N.Y., USA) encoding human PiT2 and PiT1, respectively, have been described [37].
The plasmid encoding the human PiT2 H502A mutant was made by using the QuickChange® XL site-directed mutagenesis kit (Stratagene, La Jolla CA, USA) according to the manufacturer's instructions. Besides the mutations creating H502A, the forward primer 5'-TTCGGGTCCTTTGCTGCCGGCGGCAATGACGT-3' and reverse primer 5'-ACGTCATTGCCGCCGGCAGCAAAGGACCCGAA-3' also generated, by introduction of a silent mutation, an NgoM IV restriction enzyme cleavage site in pOJ74, which was used for screening. The plasmid encoding the human PiT1 E70K mutant was made by using the Altered sites II kit (Promega, Madison WI, USA) according to the manufacturer's instructions. A mutation creating E70K as well as a Dra I restriction enzyme cleavage site was introduced into a pAlter-1 vector (Promega) harboring the Pst 1 - Hind III fragment of pOJ75 (the nucleotide sequence encoding the N-terminal part of the human PiT1 protein) using the primer 5'-GACAGAGCCCACTGTTTTAAAGATGCTAGCTAG-3'. Finally, this construct was digested with Kpn I and Hind III generating a fragment, which was used to replace the corresponding fragment in pOJ75 resulting in the desired plasmid.
The plasmid encoding the human PiT2ΔL183-V483 mutant has previously been described [31]. The plasmid encoding the human PiT2ΔR254-V483 mutant was made using a pAlter-1 vector harboring the Pst I - Hind III fragment of pOJ74 (the nucleotide sequence encoding the N-terminal part of the human PiT2 protein) as template in a polymerase chain reaction (PCR) with the forward primer 5'CTATAGGGAGACCCAAGCTTTGTTTATTTAA3' and the reverse primer 5'GAGGACCTGGAGGAAATGGAACAGGAGGTGTGATAAAGCACCTTCTTTTTG3'; the latter primer was used to create the link between the 5' sequence encoding KEGALS253 and the 3' sequence encoding H484LLFH (Figure 1). The amplification product was digested with Sse 8387 I and Hind III and used to replace the corresponding fragment in pOJ74 resulting in the desired plasmid.
The authenticities of all the nucleotide sequences were confirmed.
The plasmids were purified using either cesium chloride (CsCl) according to the protocol described by Maniatis and coworkers [38], or using Nucleobond (Macherey-Nagel, Düren, Germany) or Qiagen maxiprep (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions.
Cell cultures
Chinese hamster ovary K1 cells, CHO K1 (ATCC CCL-61) and dog osteosarcoma cells, D17 (ATCC CCL-183), were cultivated as described [37]; Mus dunni tail fibroblasts, MDTF (ATCC CCL-2017) were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS), 100IU per mL of penicillin (P), and 100 μg of streptomycin (S) per mL (D-MEM/FBS/PS). A-MLV (4070A isolate), 10A1 MLV, and Gibbon ape leukemia virus (GALV, SEATO) pseudotypes of the β-galactosidase-encoding transfer vector G1BgSvN [39] were obtained from the producer cell lines PA317GBN, PT67GBN, and PG13GBN, respectively [40-42]. PT67GBN was established as described [28]. All packaging cells were cultivated in DMEM supplemented with 10% newborn calf serum (NCS) and PS (D-MEM/NCS/PS). Feline leukemia virus subgroup B (FeLV-B) vector pseudotypes carrying the G1BgSvN transfer vector were made essentially as described [43]. Vectors were harvested as supernatants from confluent producer cells, and the vector containing supernatants were filtered (0.45-μm pore size) and stored at -80°C.
Transient transfection and infection assay
Transient transfection-infection assays were performed essentially as described [37]. Briefly, CHO K1 cells seeded in 60-mm-diameter dishes at 8 × 104 cells per dish were transfected with 2 μg per dish of plasmid DNA encoding human PiT2 (pOJ74), human PiT1 (pOJ75), human PiT2 H502A, human PiT1 E70K, or equimolar amounts to human PiT2 of human PiT2ΔR254-V483 or human PiT2ΔL183-V483. Mock treated cells were transfected with empty vector DNA (pcDNA1ARtkpA). Three independent precipitates were made per construct. Forty-eight hours after transfection, approx. 4 to 8 × 104 10A1 MLV or A-MLV pseudotypes carrying the G1BgSvN transfer vector were added per dish in the presence of Polybrene. Forty-eight hours later, the dishes were stained and evaluated. Infection was analyzed by counting the number of β-galactosidase-positive (infected) cells per dish. Analyses for FeLV-B and GALV receptor functions were performed on MDTF cells using 1.5 × 104 cells and approx. 1.5 to 3.0 × 104 vector pseudotypes per dish. Numbers of vector pseudotypes used in the experiments were calculated from the number of β-galactosidase-positive colonies per mL obtained on D17 cells as described [37].
32Pi transport assay
Female Xenopus laevis (X. laevis) frogs were obtained from Nasco (Nasco, Modesto CA, USA) and kept and handled according to guidelines from the Danish Animal Experiments Inspectorate. Oocytes were isolated from frogs anesthetized in a 0.1-0.2% MS.222 (3-aminobenzoic acid ethyl ester) (Sigma, St. Louis MO, USA) solution for 10-30 minutes. A 1-1.5 centimeters incision was made in the abdomen and several ovaries were removed surgically by authorized personnel. The oocytes were manually dissected and subsequently collagenase (Sigma, St. Louis MO, USA) treated and maintained in modified Barth's solution [88 mM NaCl, 1 mM KCl, 0.82 mM MgSO4, 0.4 mM CaCl2, 0.33 mM Ca(NO3)2, 2.4 mM NaHCO3, 10 mM HEPES-KOH, pH 7.5, 100 IU per mL penicillin, 100 μg per mL streptomycin] at 18°C as described [28]. The following day, the oocytes were used for cRNA injection and subsequent analyses of 32Pi uptake essentially as described previously [28]. Briefly, cRNAs were prepared from Apa 1 (Figure 3A) or Bln 1 (Figures 3B and 6) linearized plasmid preparations applying the mMESSAGE mMACHINE kit (Ambion, Austin TX, USA). Stage V-VI oocytes were microinjected with 12.5 ng of cRNA (or H2O as negative control) and incubated at 18°C. After two to three days, the oocytes were washed in phosphate-free uptake solution [100 mM NaCl, 2 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 10 mM HEPES-Tris pH 7.5], and hereafter incubated in uptake solution containing 0.1 mM KH232PO4 (2 mCi per mL, New England Nuclear, Boston MA, USA) at RT for 1 hour. The oocytes were washed in ice-cold uptake solution containing 5 mM KH2PO4 and the 32Pi uptake of each oocyte measured in a liquid scintillation counter as described previously [28]. It should be noted that factors coupled to the health and husbandry of the female X. laevis frogs can influence the oocyte batches. These factors include nutrition, season of the year (light cycle), water temperature, salinity and hardness of the water, water contaminants or toxins, and diseases [44], and the impact is that different batches of oocytes injected with cRNAs encoding the same proteins exhibit different average transport capacities.
Figure 3. Analysis of human PiT1 E70K and PiT2 H502A for Na32Pi uptake and gamma-retroviral receptor function. A-B X. laevis oocytes were injected with H2O (Mock) or cRNA of the indicated constructs. Three days later, a 32Pi uptake assay was performed and the 32Pi uptake in individual oocytes was measured. Data are the mean value of (n) numbers
of oocytes ±SEM, see Additional File 2 for data and statistics. Experiments A and B were made independently of each other,
and the experiments were repeated and similar results obtained. C CHO K1 cells were
transfected with CsCl-purified PiT1- or PiT1 E70K-encoding plasmid or empty vector DNA (Mock). Three independent precipitates were
made for each construct. Forty-eight hours after transfection, approx. 8 × 104 10A1 MLV pseudotypes were added per dish. The average numbers (±SEM) of blue (infected)
cells per dish from three dishes receiving independent precipitates are shown, see
Additional File 2 for data and statistics. D-E were made in parallel using the same protocol as in
(C) with the exception that Nucleobond-purified plasmids encoding PiT2, PiT2 H502A, or empty vector DNA were used. The dishes were challenged with approx. 4 × 104 10A1 MLV pseudotypes (D) or A-MLV pseudotypes (E). The average numbers (±SEM) of blue
(infected) cells per dish from three dishes receiving independent precipitates are
shown, see Additional File 2 for data and statistics.
Statistical analysis
The null hypothesis that two mean values are identical was tested by a two-tailed Student's t-test. The test compares the actual difference between two mean values in relation to the variation in the data (expressed as the standard error of the difference between the mean values). The null hypothesis was rejected, e.g., the mean values were considered different when P<0.05.
Results and discussion
Human PiT1 E70 and human PiT2 H502 are critical for Pi transport function but dispensable for gamma-retroviral receptor function
In a former study, we identified the putative 2nd-TM domain-positioned human PiT2 E55 as being critical for PiT2 Pi transport function (Figure 1) [28]. The human PiT2 paralog, human PiT1, harbors a corresponding glutamate in position 70, E70. To investigate whether this conserved residue was important for PiT1 Pi transport function, it was mutated to a lysine generating the mutant human PiT1 E70K. In the experiment shown in Figure 3A, oocytes injected with cRNA encoding human PiT1 supported a 32Pi uptake of 119.86 ±28.16 pmol/oocyte-hour at pH 7.5 in agreement with previous results obtained addressing the Na32Pi uptake function of human PiT1 in X. laevis oocytes [45]. The Pi transport function of human PiT1 E70K was severely impaired when compared to that of wildtype PiT1 (P = 0.002, 2.78 ±0.74 pmol/oocyte-hour (PiT1 E70K)) (Figure 3A); see Additional File 2 for data and statistics to Figure 3.
Additional File 2. Data and statistics. Average 32Pi uptakes in oocytes given as pmol/oocyte-hour ±SEM, information regarding the number (n) of oocytes measured, and the statistics (P values) for Figures 3A-B and Figure 6 are available in Additional File 2. Average numbers of blue (infected) cells per dish from three dishes ±SEM and the statistics (P values) for Figures 3C-E are available in Additional File 2. Average loop lengths given as amino acids ±SEM and information regarding the number (n) of loops counted for Figure 4B are available in Additional File 2.
Format: PDF Size: 98KB Download file
This file can be viewed with: Adobe Acrobat Reader
Besides being Pi-transporting proteins, the mammalian PiT proteins also serve as gamma-retroviral receptors, and this dual-function allows for analyzing whether a mutated PiT protein is properly processed, folded and translocated to the cell surface [18,28]. The human PiT1 E70K mutant was therefore analyzed for gamma-retroviral receptor function using a transient transfection-infection assay [37]. For the infection assay, retroviral vectors harboring a β-galactosidase encoding transfer vector and carrying viral surface proteins responsible for receptor recognition were used; vectors carrying, e.g., 10A1 MLV surface proteins are referred to as 10A1 MLV vector pseudotypes. Eukaryotic expression plasmids encoding human PiT1 and human PiT1 E70K mutant protein were transfected into CHO K1 cells non-permissive for infection by 10A1 MLV vector pseudotypes (Figure 3C) [28]. The abilities of these proteins to support infection by 10A1 MLV vector pseudotypes were analyzed; the infection levels were evaluated as the number of β-galactosidase positive (blue) cells per 60-mm-diameter dish. CHO K1 cells expressing human PiT1 were permissive for infection by 10A1 MLV vector pseudotypes (Figure 3C) in agreement with PiT1's well-described receptor function for 10A1 MLV [10]. Moreover, the human PiT1 E70K mutant supported wildtype PiT1 levels of 10A1 MLV infection (884 ±146 blue cells per dish (PiT1), 767 ±42 blue cells per dish (PiT1 E70K), P = 0.48) (Figure 3C). Besides being a receptor for 10A1 MLV, PiT1 is also a receptor for GALV [7] and for FeLV-B [13]. The human PiT1 E70K protein was analyzed in parallel for receptor function for vector psedotypes of these two viruses in non-permissive Mus dunni tail fibroblasts and found to sustain wildtype PiT1 infection levels of GALV (2087 ±780 blue cells per dish (PiT1), 1992 ±273 blue cells per dish (PiT1 E70K), P = 0.91) and FeLV-B (1424 ±346 blue cells per dish (PiT1), 1715 ±527 blue cells per dish (PiT1 E70K), P = 0.67). The wildtype receptor functions of PiT1 E70K confirm that the overall membrane topology is preserved and that the processing to the cell surface was unaffected by the E70K-mutation.
The glutamate E70 in human PiT1 is conserved in eukaryotic PiT family members as are the other two human PiT1 residues (S128 and S621) (Additional File 1 Figure A) previously shown to be critical for Pi transport function [29]. Since the corresponding glutamate and serine residues in human PiT2 have already been identified as being critical for Pi transport function [27,28], this demonstrate that equivalent glutamate or serine residues in the human PiT paralogs both are critical for their Pi transport functions. These observations illustrate that it is highly likely that the other conserved amino acids identified in human PiT2 as being critical for Pi transport function also are important for the transport function of human PiT1 and other PiT family members.
The histidine residue, human PiT2 H502 is positioned in the 7th TM domain according to the Johann topology model (Figure 1) [20]. It is, moreover, located in the C-terminal PiT family signature sequence and conserved in eukaryotic PiT family members [18] (Additional File 1 Figure A). Moreover, analysis of 60 sequences of bacterial PiT family members revealed only 5 sequences without the histidine residue illustrating that this residue is also highly preserved in the C-terminal PiT family signature sequence of PiT family members belonging to this kingdom [18] (Additional File 1 Figure A). Since the conserved aspartic acid in the C-terminal PiT family signature sequence, that is human PiT2 D506, is critical for Pi transport of PiT2 [18], we hypothesized that other conserved amino acids in this motif might be critically involved in Pi transport function of human PiT2 and other members of the PiT family as well. Mutation of human PiT2 H502 to alanine created the mutant denoted PiT2 H502A. This mutant was analyzed for 32Pi transport function in X. laevis oocytes (Figure 3B) and 10A1 MLV and A-MLV receptor functions in CHO K1 cells (Figures 3D-E).
In the experiment shown in Figure 3B, oocytes injected with cRNA encoding human PiT2 supported a 32Pi uptake of 44.96 ±0.46 pmol/oocyte-hour at pH 7.5 in agreement with former studies addressing the Na32Pi uptake function of human PiT2 in X. laevis oocytes [18,28,45]. The Pi transport function of human PiT2 H502A was severely impaired when compared to that of wildtype PiT2 (P = 0.002, 2.36 ±0.56 pmol/oocyte-hour (PiT2 H502A)) (Figure 3B).
To analyze whether the human PiT2 H502A mutant is properly folded and processed to the cell surface, it was also analyzed for gamma-retroviral receptor function using the transient transfection-infection assay [37]. Eukaryotic expression plasmids encoding human PiT2 and human PiT2 H502A mutant protein were transfected into CHO K1 cells non-permissive for infection by A-MLV and 10A1 MLV vector pseudotypes (Figures 3D-E) [28,37]. CHO K1 cells expressing human PiT2 were permissive for infection by both A-MLV and 10A1 MLV vector pseudotypes (Figures 3D-E) in agreement with PiT2's well-described receptor function for A-MLV and 10A1 MLV [8,10,37]. Moreover, the human PiT2 H502A mutant supported wildtype PiT2 levels of 10A1 MLV infection (63,940 ±8076 blue cells per dish (PiT2), 50,408 ±4005 blue cells per dish (PiT2 H502A), P = 0.23) (Figure 3D) and A-MLV infection (13,624 ±862 blue cells per dish (PiT2), 12,235 ±1189 blue cells per dish (PiT2 H502A), P = 0.48) (Figure 3E). These results demonstrate that the overall membrane topology of human PiT2 H502A is preserved, and that the processing of human PiT2 H502A to the membrane surface is unaffected by the mutation. Thus, histidine 502 in the 7th TM domain is the second amino acid - besides D506 - in the C-terminal PiT family signature sequence [HGANDVQNAIGP], which has been shown to be essential for human PiT2 Pi transport function. While the exact role of the histidine residue in the C-terminal signature sequence still needs to be revealed, its critical role for human PiT2 Pi transport function emphasizes the importance of the C-terminal PiT family signature sequence in the physiological function of the PiT proteins.
Besides human PiT1 E70 and human PiT2 H502, six conserved amino acids in human PiT2 and two corresponding positions in human PiT1 have previously been identified as being critical for Pi transport function [18,27-29]. All these amino acids are located in the ProDom domains (PD001131) suggested in 2004 to define members of the PiT family (Figure 1) [27]. Therefore it is likely that sequences outside these two domains might be dispensable for the Pi transport function of the PiT proteins, and that a minimal Pi-transporting unit of the PiT proteins can be identified.
Alignment of protein sequences of PiT family members from all kingdoms
A previously published alignment of human PiT1 and human PiT2 protein sequences shows that the L6 loop - the large intracellular domain - is the region where these sequences diverge the most [8] (Additional File 1 Figure A). Moreover, alignment of human PiT1 and N. crassa Pho-4+ shows that the large intracellular domain (L6) is smaller in Pho-4+, whereas the rest of the Pho-4+ protein sequence aligns well with the protein sequence of human PiT1 [20] (Additional File 1 Figure A). To further address this, we counted the number of amino acids in the large intracellular domain (L6) of nine different PiT family members and plotted the lengths according to their phylogenetic relationship in Figure 4A. The figure shows that PiT family members from archaea and bacteria harbor the shortest L6 loops whereas the PiT-proteins from chordates harbor the longest L6 loops (Figure 4A, see also Additional File 1 Figure A). Note that the L6 loop of the C. elegans putative phosphate permease is unexpectedly short (73 amino acids), and according to the plot we would have expected a L6 loop length for this protein in the interval between 175 and 232 amino acids (Figure 4A). The observed differences in the L6 loop lengths of PiT family members from different species thus suggest that the L6 loop evolved from being a regular loop to become a regular domain during evolution. In order to address this issue, we counted the number of amino acids in all loops (L1 to L9) in the nine PiT family members and plotted the average loop lengths ±SEM in Figure 4B. The figure shows that the L6 loop in average is much larger than all other loops (L6: >131.7 ±32.8 amino acids, Figure 4B); see Additional File 2 for data to Figure 4B. The figure also shows that the variation in the L7 loop lengths is substantial (42.9 ±14.7 amino acids), see Figure 4B legend for discussion. Thus, with 95% confidence the longest regular loop is the L3 loop with a maximum length of 42 amino acids, see legend to Figure 4B for discussion. The definition of the maximum length of a loop also has the impact that the L7 of E. coli PiTA consisting of 160 amino acids (Additional File 1 Figure A) has to be considered a domain. In summary, analysis of the sizes of the loop sequences L1 to L9 in nine PiT family members from all kingdoms led to the determination of a limit of maximum 42 amino acids in a regular loop sequence - and sequences longer than 42 amino acids are highly likely domains. In support of our calculations of the maximum loop length for PiT-proteins is a previous study of 243 transmembrane domain-containing sequences, with 146 sequences being multi-transmembrane spanning, showing that ~90% of the loops are shorter than 40 amino acid residues [46]. Another study supporting our finding is the analysis of loops in 79 existing 3D structures of transmembrane proteins showing that the majority of loops connecting transmembrane domains are shorter than 50 amino acid residues [47].
Figure 4. Investigation of the loop sequence length in PiT family members. A The amino acid lengths of loop 6 (L6) are plotted for nine PiT family members
(H. sapiens PiT2, H. sapiens PiT1, N. crassa Pho-4+, A. thaliana Pht2_1, E. coli PiTA, and putative phosphate permeases from D. melanogaster, C. elegans, T. brucei, and A. fulgidus). The L6 lengths are defined by the predicted TM domains in the protein sequences
of the PiT family members; see alignment in and legend to Additional File 1 Figure A (AF 1 A). The maximum limit of a loop length (42 amino acids) estimated
in Figure 4B is indicated on the figure. It illustrates that loop lengths at 1 to 42 amino acids
define a loop sequence and loop lengths at 43 amino acids or higher defines a domain.
B The numbers of amino acids in loop 1 (L1) to loop 9 (L9) in the protein sequences
listed in the legend to A are shown. The loop lengths were defined by the sequences
connecting the predicted TM domains in the protein sequences for the nine PiT family
members; see alignment in and legend to Additional File 1 Figure A (AF 1 A). Data are the mean value of (n) numbers of loops counted ±SEM,
see Additional File 2 for data. The stippled line indicates the maximum length for a loop sequence (L3)
which is ~ 42 amino acids given with 95% confidence (38.6 ±3.4 amino acids ~ 35 to
42 amino acids). Note that the 95% confidence interval for L7 is 42.9 ±28.8 amino
acids, illustrating that this loop length is subjected to high uncertainty because
of an unusually long L7 in E. coli PiTA. The 95% confidence interval for L7 calculated when excluding L7 E. coli PiTA is 28.3 ±2.4 amino acids. The topology model indicates the positions of L1 to
L9; stippled loops indicate the observed variable lengths of L6 (the large intracellular
domain).
The proteins in Figure 4A with L6 loop sizes smaller than 42 amino acids are the archaeal putative phosphate permease and the bacterial PiTA protein, implying that single cell organisms without nuclei that rarely harbor membrane-bound organelles cope without the large intracellular domain, whereas single cell animals (protozoan's) with nuclei and membrane-bound organelles have distinct L6 domains as shown for the T. brucei putative phosphate permease (Figure 4A). Altogether this suggest a role(s) for the large intracellular domain, which is not directly related to Pi transport per se, and it also suggest that the large intracellular domain (L6) may have increased in length during the evolution from archaea to chordata as a consequence of adaptation to more complex environments.
Besides a difference in the lengths of L6, a difference in the number of TM domains in the PiT family members was observed (Additional File 1 Figures A and B). The illustration of TM domain conservedness (black boxes) and TM domains, which are suggested by us to be present but not predicted by protein sequence analysis using the TMHMM server (red boxes, see argumentation in legend to Additional File 1 Figure A), shows the following conservedness of TMs: TM 4, TM 8, TM 10 (fully conserved) > TM 5, TM 6 (fully conserved in eukaryotes) > TM 1, TM 2, TM 3 > TM 9 > TM 7 (least conserved) (Additional File 1 Figure B). The most prominent observation is that E. coli PiTA and A. fulgidus putative phosphate permease both lack the 5th and 6th TM domains (Additional File 1 Figures A and B). This in addition to the previous observation that these two proteins also lack the L6 domain (Figure 4A), suggest that the 5th and 6th TM domains and the L6 domain are dispensable for Pi transport function, and that a basic Pi-transporting unit of the PiT family members can be identified. This unit would consist of regions flanking the large intracellular domain (L6) but highly likely also be devoid of the 5th and 6th TM domains. Interestingly, in support of this theory, drawing of the putative topology models for human PiT2, E. coli PiTA, and A. fulgidus putative phosphate permease based on the alignment in Additional File 1 Figure A, shows that the bacterial and archaeal proteins have a predicted eight TM backbone where the N-terminal PiT-family signature sequence is placed in the 1st extracellular loop (L1) and the C-terminal PiT family signature sequence is placed in the 3rd extracellular loop (L7) (Figure 5). In comparison, the drawing of the putative topology model for human PiT2 shows a backbone of 10 TM domains where the N-terminal and C-terminal PiT-family signature sequences are placed in the 1st extracellular loop (L1) and the 4th extracellular loop (L7), respectively (Figure 5). An interpretation of these drawings could be that the intra-protein locations of the N-terminal and C-terminal PiT-family signature sequences are of importance, and that TM 1 to TM 4 and TM 7 to TM 10 constitute a core sustaining the Pi-transporting function whereas TM 5 and TM 6 and the large intracellular domain (L6) constitute a regulatory unit. Finally, the amino acids identified as being critical for Pi transport function are located in the ProDom domains suggested in 2004 (TM 1 to TM 4 and TM 7 to TM 10) [27] (Figure 1) in agreement with the 5th and 6th TM domains and the large intracellular domain (L6) might be dispensable for the Pi transport function.
Figure 5. Predicted topologies of H. sapiens PiT2, E. coli PiTA, and A. fulgidus putative phosphate permease. Illustrations of the putative topology of H. sapiens PiT2, E. coli PiTA, and A. fulgidus putative phosphate permease are shown. TM domains were predicted using the TMHMM server
(H. sapiens PiT2) and the DAS server (E. coli PiTA and A. fulgidus putative phosphate permease) (Additional File 1 Figure A), see "Methods" for description. The N-terminal and C-terminal PiT-family
signature sequences [18] are given in grey letters, and grey stippled lines indicate the predicted placement.
Design of human PiT2 truncation mutants
To identify the minimal Pi-transporting unit, two human PiT2 truncation mutants were analyzed. They were designed to address the Pi transport function and the gamma-retroviral receptor functions of: 1) A human PiT2 mutant protein, which consists of the 10 TM domains and a L6 loop of 18 amino acids (human PiT2 P236-S253) creating the mutant human PiT2ΔR254-V483. The human PiT2ΔR254-V483 mutant does not resemble a naturally occurring homolog found in lower species, and it is merely designed to address if the large intracellular domain is dispensable for Na+-dependent Pi-uptake (Figure 1), and 2) A human PiT2 mutant protein that resembles an archaeal and bacterial homolog with respect to protein composition, i.e., lacking the 5th and 6th TM domains and the large intracellular domain (L183-V483) (human PiT2ΔL183-V483) (Figure 1). Note that in the Salaün model the 5th and 6th TM domains correspond to TMVI and TMVII (Figure 2).
The large intracellular domain (R254-V483) of human PiT2 is dispensable for Pi transport function whereas the fragment L183-V483 is more critical for Pi transport function
The Na+-dependent 32Pi transport function of wildtype human PiT2 and the human PiT2-derived truncation mutants PiT2ΔL183-V483 and PiT2ΔR254-V483 (Figure 1) were analyzed in X. laevis oocytes (Figure 6).
Figure 6. Na32Pi uptake mediated by human PiT2 and truncation mutants analyzed in X. laevis oocytes. Oocytes were injected with H2O or cRNA of the indicated constructs. Two (experiment A) or three (experiment B)
days later, a 32Pi uptake assay was performed and the 32Pi uptake in individual oocytes was measured. Data are the mean value of (n) numbers
of oocytes ±SEM, see Additional File 2 for data and statistics.
Oocytes injected with cRNA encoding human PiT2 supported a 32Pi uptake of 79.61 ±17.74 pmol/oocyte-hour (Figure 6A) and 44.96 ±0.46 pmol/oocyte-hour (Figure 6B) at pH 7.5 in agreement with previous results [18,28,45].
The 32Pi transport activities of the PiT2 mutant lacking the major part of the large intracellular domain, human PiT2ΔR254-V483, (47.38 ±6.59 pmol/oocyte-hour (Figure 6A) and 38.74 ±3.73 pmol/oocyte-hour (Figure 6B)) were indistinguishable from those of PiT2 (P = 0.119) (Figure 6A) and P = 0.553 (Figure 6B)); see Additional File 2 for data and statistics to Figure 6. Thus, the large intracellular domain of human PiT2 but 18 amino acids (fragment R254-V483) is dispensable for its Pi transport function.
The 32Pi transport activity of the human PiT2 mutant lacking the large intracellular domain as well as the 5th and 6th TM domains, PiT2ΔL183-V483 (Figure 1), was severely impaired (3.93 ±0.44 pmol/oocyte-hour (Figure 6A) and 8.33 ±2.85 pmol/oocyte-hour (Figure 6B)) when compared to the Pi transport function of wildtype PiT2 (P = 0.003 (Figure 6A) and P = 0.004 (Figure 6B)). However, interestingly the mutant did support low levels of Pi uptake significantly different from H2O-injected oocytes (2.56 ±0.24 pmol/oocyte-hour (Figure 6A) and 3.24 ±0.17 pmol/oocyte-hour (Figure 6B)) (P = 0.011 (Figure 6A) and P = 0.008 (Figure 6B)).
Viral receptor function of mutant PiT2 proteins
Using the transient transfection-infection assay, we analyzed whether the deletions in human PiT2 affected their viral receptor functions for A-MLV and 10A1 MLV. Eukaryotic expression plasmids encoding human PiT2 and the mutant proteins were transfected into CHO K1 cells. As expected, human PiT2 transfected cells were permissive for infection by both 10A1 MLV and A-MLV vector pseudotypes (Table 1). While the human PiT2 truncation mutant lacking the large intracellular domain, human PiT2ΔR254-V483 (Figure 1) was a fully functional Pi transporter (Figure 6), it only supported low levels of PiT2 cognate gamma-retroviral infection (Table 1). Note that human PiT2ΔR254-V483 was tested once for A-MLV receptor function and twice for 10A1 MLV receptor function. The A-MLV study was done in parallel to a 10A1 MLV receptor function study using the same set of plasmid precipitates. Interestingly, the human PiT2 truncation mutant lacking the 5th and 6th TM domains in addition to the large intracellular domain, human PiT2ΔL183-V483 (Figure 1), supported substantial levels of PiT2 cognate gamma-retroviral infection (Table 1) [31] showing that its low levels of Pi transport function were not due to incorrect processing of this mutant to the cell surface.
Table 1. Levels of 10A1 MLV and A-MLV entry supported by human PiT2 and derived truncation mutantsa.
PiT2 regions directly involved in receptor function for 10A1 MLV and A-MLV have also been identified by expression of chimeric proteins in CHO K1 cells and were found to be located in the putative extracellular loops 2 (L3) and 4 (L7) (Figure 1) [26,37,48,49]. Both of the human PiT2 mutants, PiT2ΔR254-V483 and PiT2ΔL183-V483, harbor extracellular loops 2 (L3) and 4 (L7) according to the Johann PiT2 model (Figure 1). Based on their - here identified - Pi transport abilities, it is unlikely that PiT2ΔR254-V483 is less expressed at the cell surface than PiT2ΔL183-V483, and the observation that the less truncated human PiT2 mutant protein is a worse gamma-retroviral receptor than a more heavily truncated human PiT2 mutant protein might instead reflect a disturbance of the folding and/or conformation of the extracellular loops 2 (L3) and 4 (L7) due to the sole presence of the extracellular loop 3 (L5) without the large intracellular domain in PiT2ΔR254-V483.
Intron-exon borders of the human PiT genes SLC20A1 and SLC20A2
The human PiT proteins are encoded by genes that localize to different chromosomes. The human gene, SLC20A1, encoding the PiT1 protein is located on chromosome 2 at position q13 [50,51], and the human gene, SLC20A2, encoding the PiT2 protein is located on chromosome 8 at position p11.2 [8,52,53].
To analyze the gene structure of SLC20A1 and SLC20A2, the intron-exon borders in each of the genes were determined using the SPIDEY mRNA-to-genome DNA alignment as described in "Methods". The intron-exon borders are marked with stars (✰) and vertical lines in the PiT1 and PiT2 protein sequences in the alignment of nine PiT family members in Additional File 1 Figure A.
Eight out of nine intron-exon borders (labeled ✰ a to e and ✰ g to i on PiT1 and PiT2 in Additional File 1 Figure A) in SLC20A1 and SLC20A2 are predicted to be homologous. One intron-exon border (labeled ✰ f1 (SLC20A2) and f2 (SLC20A1)) are displaced giving a gap corresponding to 12 amino acids (~36 nucleotides). These two borders are placed in the middle of the genome sequences, which encode the large intracellular domain (L6) of the human PiT proteins. As seen from Additional File 1 Figure A, the alignment between the human PiT proteins in this region is poor and the gap highly likely reflects this, and not a significant difference in intron-exon structure between SLC20A1 and SLC20A2.
Interestingly, in support of the theory that the 5th and 6th TM domains can be dispensable for Pi transport function, is the observation that these TM domains are encoded by two different exons, see Additional File 1 Figure A (✰ labeled c to d, and ✰ labeled d to e), and therefore the possibility exists that the sequences in these two exons have entered later in evolution.
Specialized functions of the mammalian PiT proteins
Mammalian PiT proteins are expressed in all tissues investigated and due to their broad expression profiles, they have been suggested to accommodate house-keeping functions, i.e., supplying cells with Pi to maintain basic cellular functions [2,20,54]. However, in recent years additional specialized functions of the PiT proteins have been reported. These include roles for PiT2 in proximal tubule phosphate reabsorption [55], and for PiT1 in regulation of parathyroid gland PTH production [56,57], cell proliferation [29,58,59], and in tumor necrosis factor (TNF) induced apoptosis [60]. Recent studies also indicate that both the PiT proteins function as Pi sensors [27,56], reviewed in [61]. Interestingly, some of these functions, that is, PiT2's suggested role in Pi sensing [27] and PiT1's role in cell proliferation and TNF-induced apoptosis [29,59,60] have been shown to be independent of the Pi transport functions of the proteins.
PiT1 has also been implicated in normal chondroblastic and osteoblastic differentiation and mineralization processes [62-66], as well as trans-differentiation of vascular smooth muscle cells to cells with characteristics of chondro-/osteoblasts in the pathologic process of vascular calcification at hyperphosphatemia [67]. More rodent in vivo models have been used to study the role of PiT1 in normal bone formation and/or embryonic development. Rats with transgenic overexpression of PiT1 showed no major bone deformity during skeletal development [57]. However, these rats displayed a slight but significant decrease in the bone mineral content of the whole skeleton together with a reduction albeit non-significant in the total bone area [57]. The role of PiT1 during embryonic mouse development has been studied by two different groups employing early conditional excision of SLC20A1 Exons 3-4 [68] and SLC20A1 Exon 5 [59], which resulted in homozygous embryonic lethality. Both studies find that the embryos are anemic and do not survive past E12.5, at which stage the morphology shows reduced growth [59,68]; the anemia was found to be due to severe defects in liver development [59]. Comparison of wildtype mice to mice with low (15%) expression of PiT1 mRNA showed that some of the latter mice displayed impaired bone mineralization at birth, while 15-days old mice showed no major differences in mineralization [59]. Interestingly, in embryos (E11.5) lacking PiT1 expression Beck and coworkers found an upregulated PiT2 expression, which however could not rescue the embryos past E12.5, and the authors therefore suggest that the critical non-redundant role of PiT1 in development is not Pi-uptake [59]. Altogether, the in vivo studies do not exclude a role for PiT1 in normal bone formation, although they imply that PiT1 is not critical for the early skeletal developmental processes.
The alignment and analyses of exon structure together with the observed Pi transport functions of the PiT2 deletion mutants presented here might suggest that the regions of the PiT proteins involved in the Pi-transport independent functions map to sequences in the 5th and 6th TM domains and/or in the large intracellular domain. In line with this, we are currently investigating the function of the large intracellular domain of the human PiT2 protein and our results support the hypothesis that the large intracellular domain has other functions than Pi transport.
Conclusions
Investigation of the Pi transport and retroviral receptor functions of the human PiT proteins has allowed for identification of a histidine residue (human PiT2 H502) in the C-terminal PiT family signature sequence as being critically involved in Pi transport function. Moreover, we show that a PiT1 glutamate residue (human PiT1 E70) positioned in the 2nd TM domain is critical for Pi transport function in agreement with the former identification of the equivalent glutamate in human PiT2 (human PiT2 E55) as being critical for Pi transport function [28].
We have shown that a human PiT2 mutant consisting of the 10 TM domains and minor loops (human PiT2ΔR254-V483) transports Pi as wildtype PiT2, proving that the large intracellular domain (L6) is dispensable for Pi transport function. A further truncated human PiT2 mutant consisting of the 1st to 4th TM domains linked to the 7th to 10th TM domains and the minor loop sequences connecting the TMs (human PiT2ΔL183-V483), and which resembles archaeal and bacterial homologs, sustained low levels of Pi transport. This protein harbors the ProDom domains defining the PiT family members and, moreover, harbors all the amino acids so far identified as being critical for Pi transport function.
The above results showing that truncated human PiT2 mutant proteins - one of which resembles a phosphate permease from bacteria and a putative phosphate permease from archaea - support Pi transport, point to the conclusion that the overall structure of the PiT family proteins has remained unchanged during evolution and that a basic Pi-transporting unit exists.
List of abbreviations used
10A1 MLV: retrovirus closely related to A-MLV, A-MLV: amphotropic murine leukemia virus, CHO K1: Chinese hamster ovary K1, GALV: gibbon ape leukemia virus, FeLV-B: feline leukemia virus subgroup B, Pi: inorganic phosphate, PiT: Pi transporter, TM: transmembrane.
Authors' contributions
PB and LP conceived the study and designed the experiments. PB did the experimental work, and drafted the manuscript. PB and LP edited and approved the final version of the manuscript.
Acknowledgements and Funding
We thank Drs. Bryan O'Hara for pOJ74 and pOJ75, Maribeth V. Eiden for the PA317GBN and PG13GBN cell lines, Joyce Dunn for the FeLV-B virus stock, and Jan Egebjerg Jensen for use of his X. laevis oocyte facilities. We furthermore thank Bente Andersen for excellent technical assistance.
This work was supported by the Lundbeck Foundation (Grant number 14/02), the Novo Nordisk Foundation, the Danish Medical Research Foundation (Grant numbers (09-058816) 22-03-0254, 09-061652 (271-06-0564), 09-063569 (271-07-0598), 09-066064 (271-08-1005), an Engineer Arne Hansen grant, and the Intramural Budget at the Institute of Clinical Medicine at Aarhus University.
References
-
Oláh Z, Lehel C, Anderson WB, Eiden MV, Wilson CA: The cellular receptor for gibbon ape leukemia virus is a novel high affinity sodium-dependent phosphate transporter.
J Biol Chem 1994, 269(41):25426-25431. PubMed Abstract | Publisher Full Text
-
Kavanaugh MP, Miller DG, Zhang W, Law W, Kozak SL, Kabat D, Miller AD: Cell-surface receptors for gibbon ape leukemia virus and amphotropic murine retrovirus are inducible sodium-dependent phosphate symporters.
Proc Natl Acad Sci USA 1994, 91(15):7071-7075. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Kavanaugh MP, Kabat D: Identification and characterization of a widely expressed phosphate transporter/retrovirus receptor family.
Kidney Int 1996, 49(4):959-963. PubMed Abstract | Publisher Full Text
-
Virkki LV, Biber J, Murer H, Forster IC: Phosphate transporters: a tale of two solute carrier families.
Am J Physiol Renal Physiol 2007, 293(3):F643-654. PubMed Abstract | Publisher Full Text
-
Wain HM, Bruford EA, Lovering RC, Lush MJ, Wright MW, Povey S: Guidelines for human gene nomenclature.
Genomics 2002, 79(4):464-470. PubMed Abstract | Publisher Full Text
-
Saier MH Jr: A functional-phylogenetic classification system for transmembrane solute transporters.
Microbiol Mol Biol Rev 2000, 64(2):354-411. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
O'Hara B, Johann SV, Klinger HP, Blair DG, Rubinson H, Dunn KJ, Sass P, Vitek SM, Robins T: Characterization of a human gene conferring sensitivity to infection by gibbon ape leukemia virus.
Cell Growth Differ 1990, 1(3):119-127. PubMed Abstract | Publisher Full Text
-
van Zeijl M, Johann SV, Closs E, Cunningham J, Eddy R, Shows TB, O'Hara B: A human amphotropic retrovirus receptor is a second member of the gibbon ape leukemia virus receptor family.
Proc Natl Acad Sci USA 1994, 91(3):1168-1172. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miller DG, Edwards RH, Miller AD: Cloning of the cellular receptor for amphotropic murine retroviruses reveals homology to that for gibbon ape leukemia virus.
Proc Natl Acad Sci USA 1994, 91(1):78-82. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miller DG, Miller AD: A family of retroviruses that utilize related phosphate transporters for cell entry.
J Virol 1994, 68(12):8270-8276. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Takeuchi Y, Vile RG, Simpson G, O'Hara B, Collins MK, Weiss RA: Feline leukemia virus subgroup B uses the same cell surface receptor as gibbon ape leukemia virus.
J Virol 1992, 66(2):1219-1222. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Wilson CA, Farrell KB, Eiden MV: Properties of a unique form of the murine amphotropic leukemia virus receptor expressed on hamster cells.
J Virol 1994, 68(12):7697-7703. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Tailor CS, Takeuchi Y, O'Hara B, Johann SV, Weiss RA, Collins MK: Mutation of amino acids within the gibbon ape leukemia virus (GALV) receptor differentially affects feline leukemia virus subgroup B, simian sarcoma-associated virus, and GALV infections.
J Virol 1993, 67(11):6737-6741. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Mann BJ, Bowman BJ, Grotelueschen J, Metzenberg RL: Nucleotide sequence of pho-4+, encoding a phosphate-repressible phosphate permease of Neurospora crassa.
Gene 1989, 83(2):281-289. PubMed Abstract | Publisher Full Text
-
Martinez P, Persson BL: Identification, cloning and characterization of a derepressible Na+- coupled phosphate transporter in Saccharomyces cerevisiae.
Mol Gen Genet 1998, 258(6):628-638. PubMed Abstract | Publisher Full Text
-
Harris RM, Webb DC, Howitt SM, Cox GB: Characterization of PitA and PitB from Escherichia coli.
J Bacteriol 2001, 183(17):5008-5014. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M: Pht2;1 encodes a low-affinity phosphate transporter from Arabidopsis.
Plant Cell 1999, 11(11):2153-2166. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Bøttger P, Pedersen L: Evolutionary and experimental analyses of inorganic phosphate transporter PiT family reveals two related signature sequences harboring highly conserved aspartic acids critical for sodium-dependent phosphate transport function of human PiT2.
Febs J 2005, 272(12):3060-3074. PubMed Abstract | Publisher Full Text
-
Werner A, Kinne RK: Evolution of the Na-P(i) cotransport systems.
Am J Physiol Regul Integr Comp Physiol 2001, 280(2):R301-312. PubMed Abstract | Publisher Full Text
-
Johann SV, Gibbons JJ, O'Hara B: GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus.
J Virol 1992, 66(3):1635-1640. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Chien ML, Foster JL, Douglas JL, Garcia JV: The amphotropic murine leukemia virus receptor gene encodes a 71- kilodalton protein that is induced by phosphate depletion.
J Virol 1997, 71(6):4564-4570. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Farrell KB, Russ JL, Murthy RK, Eiden MV: Reassessing the role of region A in Pit1-mediated viral entry.
J Virol 2002, 76(15):7683-7693. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Farrell KB, Tusnady GE, Eiden MV: New structural arrangement of the extracellular regions of the phosphate transporter SLC20A1, the receptor for gibbon ape leukemia virus.
J Biol Chem 2009, 284(43):29979-29987. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Salaün C, Rodrigues P, Heard JM: Transmembrane topology of PiT-2, a phosphate transporter-retrovirus receptor.
J Virol 2001, 75(12):5584-5592. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Pedersen L, van Zeijl M, Johann SV, O'Hara B: Fungal phosphate transporter serves as a receptor backbone for gibbon ape leukemia virus.
J Virol 1997, 71(10):7619-7622. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Lundorf MD, Pedersen FS, O'Hara B, Pedersen L: Amphotropic murine leukemia virus entry is determined by specific combinations of residues from receptor loops 2 and 4.
J Virol 1999, 73(4):3169-3175. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Salaün C, Maréchal V, Heard JM: Transport-deficient Pit2 phosphate transporters still modify cell surface oligomers structure in response to inorganic phosphate.
J Mol Biol 2004, 340(1):39-47. PubMed Abstract | Publisher Full Text
-
Bøttger P, Pedersen L: Two highly conserved glutamate residues critical for type III sodium-dependent phosphate transport revealed by uncoupling transport function from retroviral receptor function.
J Biol Chem 2002, 277(45):42741-42747. PubMed Abstract | Publisher Full Text
-
Beck L, Leroy C, Salaun C, Margall-Ducos G, Desdouets C, Friedlander G: Identification of a novel function of PiT1 critical for cell proliferation and independent of its phosphate transport activity.
J Biol Chem 2009, 284(45):31363-31374. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Saier MH Jr: Eukaryotic transmembrane solute transport systems.
Int Rev Cytol 1999, 190:61-136. PubMed Abstract | Publisher Full Text
-
Bøttger P, Pedersen L: The central half of Pit2 is not required for its function as a retroviral receptor.
J Virol 2004, 78(17):9564-9567. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Higgins DG: CLUSTAL V: multiple alignment of DNA and protein sequences.
Methods Mol Biol 1994, 25:307-318. PubMed Abstract
-
Sonnhammer EL, von Heijne G, Krogh A: A hidden Markov model for predicting transmembrane helices in protein sequences.
Proc Int Conf Intell Syst Mol Biol 1998, 6:175-182. PubMed Abstract
-
Cserzo M, Wallin E, Simon I, von Heijne G, Elofsson A: Prediction of transmembrane alpha-helices in prokaryotic membrane proteins: the dense alignment surface method.
Protein Eng 1997, 10(6):673-676. PubMed Abstract | Publisher Full Text
-
Acquisti C, Kleffe J, Collins S: Oxygen content of transmembrane proteins over macroevolutionary time scales.
Nature 2007, 445(7123):47-52. PubMed Abstract | Publisher Full Text
-
Wheelan SJ, Church DM, Ostell JM: Spidey: a tool for mRNA-to-genomic alignments.
Genome Res 2001, 11(11):1952-1957. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Pedersen L, Johann SV, van Zeijl M, Pedersen FS, O'Hara B: Chimeras of receptors for gibbon ape leukemia virus/feline leukemia virus B and amphotropic murine leukemia virus reveal different modes of receptor recognition by retrovirus.
J Virol 1995, 69(4):2401-2405. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Maniatis , Sambrook , Fritsch : Molecular Cloning, A Laboratory Manual. 3rd edition. Cold Spring Harbor Laboratory Press; 1989.
-
McLachlin JR, Mittereder N, Daucher MB, Kadan M, Eglitis MA: Factors affecting retroviral vector function and structural integrity.
Virology 1993, 195(1):1-5. PubMed Abstract | Publisher Full Text
-
Miller AD, Chen F: Retrovirus packaging cells based on 10A1 murine leukemia virus for production of vectors that use multiple receptors for cell entry.
J Virol 1996, 70(8):5564-5571. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miller AD, Buttimore C: Redesign of retrovirus packaging cell lines to avoid recombination leading to helper virus production.
Mol Cell Biol 1986, 6(8):2895-2902. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miller AD, Garcia JV, von Suhr N, Lynch CM, Wilson C, Eiden MV: Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus.
J Virol 1991, 65(5):2220-2224. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Dreyer K, Pedersen FS, Pedersen L: A 13-amino-acid Pit1-specific loop 4 sequence confers feline leukemia virus subgroup B receptor function upon Pit2.
J Virol 2000, 74(6):2926-2929. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Godfrey EW, Sanders GE: Effect of water hardness on oocyte quality and embryo development in the African clawed frog (Xenopus laevis).
Comp Med 2004, 54(2):170-175. PubMed Abstract | Publisher Full Text
-
Bøttger P, Hede SE, Grunnet M, Høyer B, Klærke DA, Pedersen L: Characterization of transport mechanisms and determinants critical for Na+-dependent Pi symport of the PiT family paralogs human PiT1 and PiT2.
Am J Physiol Cell Physiol 2006, 291(6):C1377-C1387. PubMed Abstract | Publisher Full Text
-
Kahsay RY, Gao G, Liao L: An improved hidden Markov model for transmembrane protein detection and topology prediction and its applications to complete genomes.
Bioinformatics 2005, 21(9):1853-1858. PubMed Abstract | Publisher Full Text
-
Viklund H, Granseth E, Elofsson A: Structural classification and prediction of reentrant regions in alpha-helical transmembrane proteins: application to complete genomes.
J Mol Biol 2006, 361(3):591-603. PubMed Abstract | Publisher Full Text
-
Leverett BD, Farrell KB, Eiden MV, Wilson CA: Entry of amphotropic murine leukemia virus is influenced by residues in the putative second extracellular domain of its receptor, Pit2.
J Virol 1998, 72(6):4956-4961. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Lundorf MD, Pedersen FS, O'Hara B, Pedersen L: Single amino acid insertion in loop 4 confers amphotropic murine leukemia virus receptor function upon murine Pit1.
J Virol 1998, 72(5):4524-4527. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Kaelbling M, Eddy R, Shows TB, Copeland NG, Gilbert DJ, Jenkins NA, Klinger HP, O'Hara B: Localization of the human gene allowing infection by gibbon ape leukemia virus to human chromosome region 2q11-q14 and to the homologous region on mouse chromosome 2.
J Virol 1991, 65(4):1743-1747. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Palmer G, Manen D, Bonjour JP, Caverzasio J: Characterization of the human Glvr-1 phosphate transporter/retrovirus receptor gene and promoter region.
Gene 1999, 226(1):25-33. PubMed Abstract | Publisher Full Text
-
Chien ML, O'Neill E, Garcia JV: Phosphate depletion enhances the stability of the amphotropic murine leukemia virus receptor mRNA.
Virology 1998, 240(1):109-117. PubMed Abstract | Publisher Full Text
-
Garcia JV, Jones C, Miller AD: Localization of the amphotropic murine leukemia virus receptor gene to the pericentromeric region of human chromosome 8.
J Virol 1991, 65(11):6316-6319. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Uckert W, Willimsky G, Pedersen FS, Blankenstein T, Pedersen L: RNA levels of human retrovirus receptors Pit1 and Pit2 do not correlate with infectibility by three retroviral vector pseudotypes.
Hum Gene Ther 1998, 9(17):2619-2627. PubMed Abstract | Publisher Full Text
-
Villa-Bellosta R, Ravera S, Sorribas V, Stange G, Levi M, Murer H, Biber J, Forster IC: The Na+-Pi cotransporter PiT-2 (SLC20A2) is expressed in the apical membrane of rat renal proximal tubules and regulated by dietary Pi.
Am J Physiol Renal Physiol 2009, 296(4):F691-699. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Miyamoto K, Ito M, Segawa H, Kuwahata M: Secondary hyperparathyroidism and phosphate sensing in parathyroid glands.
J Med Invest 2000, 47(3-4):118-122. PubMed Abstract
-
Suzuki A, Ammann P, Nishiwaki-Yasuda K, Sekiguchi S, Asano S, Nagao S, Kaneko R, Hirabayashi M, Oiso Y, Itoh M, Caverzasio J: Effects of transgenic Pit-1 overexpression on calcium phosphate and bone metabolism.
J Bone Miner Metab 2010, 28(2):139-148. PubMed Abstract | Publisher Full Text
-
Kimata M, Michigami T, Tachikawa K, Okada T, Koshimizu T, Yamazaki M, Kogo M, Ozono K: Signaling of extracellular inorganic phosphate up-regulates cyclin D1 expression in proliferating chondrocytes via the Na+/Pi cotransporter Pit-1 and Raf/MEK/ERK pathway.
Bone 2010, 47(5):938-947. PubMed Abstract | Publisher Full Text
-
Beck L, Leroy C, Beck-Cormier S, Forand A, Salaun C, Paris N, Bernier A, Urena-Torres P, Prie D, Ollero M, Coulombel L, Friedlander G: The phosphate transporter PiT1 (Slc20a1) revealed as a new essential gene for mouse liver development.
PLoS One 2010, 5(2):e9148. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Salaun C, Leroy C, Rousseau A, Boitez V, Beck L, Friedlander G: Identification of a novel transport-independent function of PiT1/SLC20A1 in the regulation of TNF-induced apoptosis.
J Biol Chem 2010, 285(45):34408-34418. PubMed Abstract | Publisher Full Text
-
Khoshniat S, Bourgine A, Julien M, Weiss P, Guicheux J, Beck L: The emergence of phosphate as a specific signaling molecule in bone and other cell types in mammals.
Cell Mol Life Sci 2011, 68(2):205-218. PubMed Abstract | Publisher Full Text
-
Nielsen LB, Pedersen FS, Pedersen L: Expression of type III sodium-dependent phosphate transporters/retroviral receptors mRNAs during osteoblast differentiation.
Bone 2001, 28(2):160-166. PubMed Abstract | Publisher Full Text
-
Palmer G, Zhao J, Bonjour J, Hofstetter W, Caverzasio J: In vivo expression of transcripts encoding the Glvr-1 phosphate transporter/retrovirus receptor during bone development.
Bone 1999, 24(1):1-7. PubMed Abstract | Publisher Full Text
-
Suzuki A, Ghayor C, Guicheux J, Magne D, Quillard S, Kakita A, Ono Y, Miura Y, Oiso Y, Itoh M, Caverzasio J: Enhanced Expression of the Inorganic Phosphate Transporter Pit-1 Is Involved in BMP-2-Induced Matrix Mineralization in Osteoblast-Like Cells.
J Bone Miner Res 2006, 21(5):674-683. PubMed Abstract | Publisher Full Text
-
Sugita A, Kawai S, Hayashibara T, Amano A, Ooshima T, Michigami T, Yoshikawa H, Yoneda T: Cellular ATP synthesis mediated by type III sodium-dependent phosphate transporter Pit-1 is critical to chondrogenesis.
J Biol Chem 2011, 286(4):3094-3103. PubMed Abstract | Publisher Full Text
-
Yoshiko Y, Candeliere GA, Maeda N, Aubin JE: Osteoblast autonomous Pi regulation via Pit1 plays a role in bone mineralization.
Mol Cell Biol 2007, 27(12):4465-4474. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
-
Li X, Yang HY, Giachelli CM: Role of the sodium-dependent phosphate cotransporter, Pit-1, in vascular smooth muscle cell calcification.
Circ Res 2006, 98(7):905-912. PubMed Abstract | Publisher Full Text
-
Festing MH, Speer MY, Yang HY, Giachelli CM: Generation of mouse conditional and null alleles of the type III sodium-dependent phosphate cotransporter PiT-1.
Genesis 2009, 47(12):858-863. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
