Table 1

Primers used for analysis of gene expression by real time quantitative RT-PCR

Accession no.

Gene

Gene name

Forward primer (5'-3')

Reverse primer (5'-3')


NM_017340

ACOX1

acyl-coenzyme A oxidase 1

AGCTGTGCTGAGGAACCTGT

CTGGTGGATGCCTTTGACTT

NM_031559

CPT-1a

carnitine palmitoyltransferase 1a

AAGGTGCTGCTCTCCTACCA

TACCTGGAATCTGTGAGGCC

NM_139192

SCD1

stearoyl-coenzyme A desaturase 1

GATATCCACGACCCCAGCTC

TACCTTATCAGTGCCCTGGG

NM_017332

FAS

fatty acid synthase

CTTTGTGGCCTTCTCCTCTG

GCAGTTTTGTGCTGGTTGAG

NM_199115

Angptl4

angiopoietin-like 4

CAGGCTACCACCCTGTTGAT

TGGACAGAGAAGAAGCCCAT

NM_001024743

UGP2

UDP-glucose pyrophosphorylase 2

GGTTTGCTCGACACCTTCAT

TACGAAGGCAAACTGAGGCT

NM_013098

G6Pase

glucose-6-phosphatase

CTACCTTGCGGCTCACTTTC

GACCTCCTGTGGACTTTGGA

NM_198780

PEPCK

phosphoenolpyruvate carboxykinase

CCCAGGAGTCACCATCACTT

GTGTCCCCCTTGTCTACGAA

NM_012571

GOT1

glutamate oxaloacetate transaminase 1

TCCAAGAACTTCGGGCTCTA

GGAGTGGAAAGGAAACGTGA

NM_022402

Arbp

acidic ribosomal phosphoprotein Pθ

CAGCAGGTGTTTGACAATGG

AAAGGGTCCTGGCTTTGCTC


Gustavsson et al. BMC Biochemistry 2010 11:38   doi:10.1186/1471-2091-11-38

Open Data